Based on dual coding theory, this study predicted that pictorial typography (PT), a device involving direct visual integration of a written word into a picture of its referent, is more effective for ESL children’s pre-literacy skills, than the non-integrated paring of word and picture on flashcards (FC). The two types of instruction were given to thirty-two Korean children aged six and seven, both embedded within the WordWorld (WW) episodes, an animated TV series developed by PBS. Results from the pre- and post-test design were as follows. PT was more beneficial than FC for the two upperlevel skills, vocabulary and reading fluency, while they were equally beneficial for the two lower-level skills, letter recognition and phonemic awareness. The two mediating variables, gender and age, were shown to have partial effects as well. Dual coding theory and the importance of instructional intervention have been supported by this study.
본 연구는 사회복귀를 예정하고 있는 수형자들의 원예치료 및 원예활동에 대한 요구와 선호도를 조사하여 사회복귀예정 수형자를 대상으로 한 교정ㆍ교화 원예치료프로그램 개발을 위한 식물 및 원예활동에 대한 기초 자료를 마련하기 위하여 수행되었다. 설문지 분석 결과, 남성, 40대, 고졸이하가 가장 많았고 사기에 기독교가 가장 많았다. 교정·교화프로그램으로써 원예치료가 제공되는 것에 대해서 바람직하다는 의견이 약 70%, 교정·교화프로그램으로써 원예치료가 제공되었을 때 60% 이상이 참여할 의사가 있다고 밝혔다. 원예활동 경험은 없는 사람이 많았고, ‘산책, 견학, 여행 등의 식물감상활동’을 가장 선호하고 다음으로‘실내외에서 식물 가꾸기’,‘식물을 이용한 장식 및 공예활동’순이었다. 선호하는 식물은 화훼를 가장 선호했고, 화훼식물 중에서는‘난초류’를, 채소식물 중에서는‘열매채소’를, 열매채소 중에서는‘토마토’를 가장 선호하는 것으로 나타났다.
The purpose of this study is to examine the effects of gait training using functional electrical stimulation on the improvement of hemiplegic patients' functions for balance and gait velocity. The subjects of the experiment were determined to be 10 each hemiplegic patients who had been diagnosed with stroke or brain damage six months or longer earlier assigned to an experimental group and a control group respectively. The subjects were evaluated before the experiment using Tetrax and 10M gait tests, received gait training five times a week for four weeks using functional electrical stimulation and were evaluated after the experiment in the same method as used in the evaluation before the experiment. In order to examine differences between the experimental group that received gait training using functional electrical stimulation and the control group that was treated by functional electrical stimulation and received gait training thereafter, differences between before and after the experiment were analyzed using paired sample t-tests and differences in changes after the experiment between the experimental group and the control group were analyzed using independent sample t-tests in order to compare the two groups with each other. Experimental results showed significant differences in weight bearing, balance and gait velocity between before and after the experiment in the experimental group(p<.05). In the control group, whereas weight bearing and gait velocity did not show any significant difference between before and after the experiment(p>.05), balance showed significant differences(p<.05). Weight bearing, balance and gait velocity change rates showed significant differences between the experimental group and the control group(p<.05). In conclusion, it was indicated that gait training using functional electrical stimulation is effective for enhancing stroke patients' weight bearing rates, balance abilities and gait velocity.
The genomic structure and phylogenetic relationships of HSP88 genes from P. tenuipes Jocheon-1, P. tenuipes, C. militaris and C. pruinosa are described. The HSP88 genomic DNA from P. tenuipes Jocheon-1, P. tenuipes and C. militaris all contain 5 introns and 6 exons with the length of 13, 62, 32, 1438, 306, 288 bp, encoding 713 amino acid residues. C. pruinosa HSP88 genomic DNA contains 4 introns and 5 exons encoding 713 amino acids. The length of each exon of C. pruinosa HSP88 is 13, 62, 32, 1744, 288 bp and the length of exon 4 is identical to the total length of exon 4 and exon 5 of HSP88 of P. tenuipes Jochoen-1, P. tenuipes, and C. militaris. The deduced amino acid sequence of P. tenuipes Jocheon-1 HSP88 showed 99% identity with the P. tenuipes, 97% identity with the Cordyceps militaris, and 98% identity with the C. pruinosa. Phylogenetic analysis confirmed that the P. tenuipes Jocheon-1, P. tenuipes, C. militaris and C. pruinosa HSP88 are placed together within the ascomycetes group of fungal clade.
In this study, a full-length heat shock protein88 complementary DNA (cDNA) of Paecilomyces tenuipes Jocheon-1 was obtained by screening of P. tenuipesJocheon-1 Uni-Zap cDNA library and 5' RACE polymerase chain reaction. The Paecilomyces tenuipes Jocheon-1 heat shock protein88 cDNA contains an open reading frame of 2,139 bp encoding 713 amino acid residues. The deduced amino acid sequence of the P. tenuipes Jocheon-1 HSP88 cDNA showed 77% identity to N. haematococca HSP88 and 45-76% identity to other fungi HSP88. Phylogenetic analysis and BLAST program analysis confirmed that the deduced amino acid sequences of the P. tenuipes Jocheon-1 HSP88 gene belonged to the ascomycetes group within the fungal clade and P. tenuipes Jocheon-1 HSP88 also contains the conserved ATPase domain at the N-terminal. The cDNA encoding P. tenuipes Jocheon-1 HSP88 was expressed as a 88 kDa polypeptide in baculovirus-infected insect Sf9 cells. Under different stress conditions, mRNA expression of P. tenuipes Jocheon-1 HSP88 were quantified by real-time PCR and the result showed that heat shock stress affected the mRNA expression levels of P. tenuipes Jocheon-1 HSP88.
Presently, We have constructed an olig-d(T) primed directional cDNA library from the silkworm Dongchunghacho, an entomopathogenic fungus, of which species is belonging to Paecilomyces tenuipes Jocheon-1. To isolate and screen genes in the fungus, 626 expressed sequence tags(ESTs) were generated by a partial sequencing from the cDNA library. Paecilomyces tenuipes Jocheon-1 cDNA encoding the glyceraldehyde-3-phosphate dehydrogenase(Pt-GAPDH) of Paecilomyces tenuipes Jocheon-1 was cloned from the above cDNA library. The complete cDNA sequence of Pt-GAPDHis comprised of 1,014bp encoding 338 amino acid residues. The deduced protein sequence of Pt-GAPDH showed higher homology with Beauberia bassiana-GAPDH(93% amino acid identity). Hydropathy analysis revealed that Pt-GAPDH protein is hydrophilic. The major three amino acids in its composition of amino acid residues were alanine(11.54%), valine(9.47%) and glycine(8.88%). The cDNA encoding Pt-GAPDH was expressed as a 37 kDa polypeptide in baculovirus-infected insect Sf9 cells. The Pt-GAPDH gene of Paecilomyces tenuipes entomopathogenic fungus consisted of three exons and two introns coding for 338 amino acid residues, and the genomic DNA length of the gene spans 1302bp. The accession number of the gene in GenBank are GU997099 for Pt-GAPDH cDNA and GU997102 for Pt-GAPDH genomic DNA.
Fungi belonging to the Paecilomyces spp. have recently been used as food and herbal medicines in Korea and are greatly popular as commercially available powdered supplement or dried fruiting body. Despite this acceptance and its use, little is known of the genes related to its reactive agents. Presently, We have constructed an olig-d(T) primed directional cDNA library from the silkworm Dongchunghacho, an entomopathogenic fungus, of which species is belonging to Paecilomyces spp. based on the previous identification of ITS1 and ITS2 at the molecular level and collected from Jocheon Miryang, Korea. To isolate and screen genes in the fungus, 626 expressed sequence tags(ESTs) were generated by a partial sequencing from the cDNA library. cDNA encoding the glyceraldehyde-3-phosphate dehydrogenase(Pt-GAPDH) of Paecilomyces tenuipes- Jocheon was cloned from the above cDNA library. The complete cDNA sequence of Pt-GAPDH is comprised of 1,014bp encoding 338 amino acid residues. The deduced protein sequence of Pt-GAPDH showed higher homology with Beauberia bassiana-GAPDH(93% amino acid identity). Hydropathy analysis revealed that Pt-GAPDH protein is hydrophilic. The major three amino acids in its composition of amino acid residues were alanine(11.54%), valine(9.47%) and glycine(8.88%). The Pt-GAPDH gene of Paecilomyces tenuipes entomopathogenic fungus consisted of three exons and two introns coding for 338 amino acid residues, and the genomic DNA length of the gene spans 1302bp. The accession number of the gene in GenBank are GU997099 for Pt-GAPDH cDNA and GU997102 for Pt-GAPDH genomic DNA. More investigation works including gene expression, immunological analysis etc. will be carried continuously without hesitation after this presentation.
A full genomic DNA microarray technique was employed to investigate the effects of Dongchunghacho on aortal and hepatic gene expression in apolipoprotein E knockout mice fed a high-fat/high-cholesterol diet. Male 8- week - old ApoE-/- mice were randomly divided into two groups, control(high cholesterol group; HC) and supplementation of Dongchunghacho (SD). All of the mice were fed a high-fet/high cholesterol diet with or without Dongchunghacho supplemented by 1% for 6 weeks. At first, lipid profile of the Dongchunghacho was measured by biochemical analysis. No differences were observed in serum triglyceride and total cholesterol levels between the two groups. Antigenotoxic effect of the Dongchunghacho was measured by the single cell gel electrophoresis assay (Comet assay) and quantified as % fluorescence in tail. Dongchunghacho supplementation decreased significantly leukocytic DNA damage and also there was a tendency of reduction in hepatic DNA damage in Dongchunghacho group compared with the control group. In up regulated genes in liver and aorta of the mice, genes with 0 to 2- fold difference in expression level between the two group (HD and SD) was very much more in liver than in aorta, on the contrary, those with 2-fold to 16-flod difference increased greatly rather in aorta than in liver. Also, almost the same results were observed in down regulated genes in liver and aorta between the two groups. These results suggested that supplementation of Dongchunghacho might be helpful in preventing leukocytic DNA damage induced by high fat diet, and has a more crucial roles in aortal gene expression.
Subterranean termites construct complicated tunnel network for foraging below the ground. Thus, they often encounter a number of tunnel intersections during their moving from place to place in the network. In order to understand how termites respond to the intersections, we artificially excavated two tunnels intersected with 90° degree in soil-filled arenas. The two tunnels had the width of W1 and W2 (=2, 3, and 4mm), respectively. We systematically observed the response behavior of advancing termites to the intersection with the combination of W1 and W2, (W1, W2). For (W1, W2)=(2, 2) and (3, 3), the advancing termites passed the intersection without directional changes because it was difficult for termites to bend their body to change their moving direction due to the small-sized width. For (W1, W2)=(4, 4), the termites statistically-equally chose the three directions, left, right, and straight, which was due to the fact that the intersection provided enough space for termites to bend. For (W1, W2)=(2, 3), (2, 4), and (3, 4), termites, advancing in narrower tunnels, tended considerably to turn right or left, while termites, advancing in wider tunnels, were favorably inclined to go straight. These results can be understood by considering the relationship between termite body length and tunnel width as explained for the cases of W1=W2. In addition, we briefly discussed our findings in relation to termite foraging efficiency.
Al thou gh it was reported that the human genome had been entirely seq uenced. so far there frequently appeared non - redundant cDNAs in gene cloning of cellular mRNAs. Consequently a lot of effort is required to ide ntified the new genes for theil‘ localization in chromosome and their functlons If the new genes had small size sequences 0 1' were expressed in low level , 5' RACE became ha rd unexpectedly. Here. we demonstrated a new method of 5’ RACE by PCR cloning using hair pin prime r and cDNA template produced by gene specific primer. Firstly .. total RNA obtained from tissue 0 1' cells is primed for rever se transcri ption (Superscript lI) by antisense primer (AS-l) specilïc to the objective gen e in order to produce single strand cDNAs The cDNAs usua lly have 3' overhanging of CCC seq uence. SeconcUy, a hail‘ pin primer overhang GGG seq uence in 3' end (i .e ‘ Tn'AGTGAGGGTTA AGAAGGAGAATTAACCCTCACTAAAGGG) is rnixed with the cDNA produced above, and 1'01- lowed by heating at 70'C for 5 min and cooled in room temperature to make hairpin-end template cDNAs Thirdly, For PCR is performed using the ha irpin-end template cDNAs and primer set of inner hairpin sense primer (i . e., TAACCCTCACTA AAGGGG) and AS-1 using pfu polymerase. And next. the PCR product can be directly sequenced 0 1' subcloned into vector to seq uence the purified plasrnid DNA. In our laboratory several unidentified new genes have been under investigation for theil‘ genomic l oci and functions. However. one of them. a human short helical protein 1 (hSHP-1) was a short gene less than 600 bp in s ize. encoding 45 amino acids . hSHP-1 is able to produce a potent antimicrobial peptide which has similar strength to magainin from frogs. The hSHP-1 also showed multifunctional roles of innate imrnunity including not only the ant imicrobial activity against methi cillin resistant strains but a lso anti- neoplastic effect on precance rous cell s . Fluorescence in situ hybricli zation in chromosome was not successful due to weak signal. and genornic Southern of hSHP-l showecl a higher weak bancl. which is not clearly definecl as an comrnon genomic locus‘ but could be cons idered its or igin from centromere region which contains less frequent restri ction sites. And more, th e ordinary PCR cloning performed pre vious ly from human genornic DNA produced only repetitive non-specific DNAs which were not matched to hSHP-l cDNA This study demonstrated how we have don e the PCR cl oning usi ng ha irpin primer and cDNA template reve rsely transcribed by gene specific primer.
om llnique miRNA encoding genes and also from intergene seqllences. 80 far it is generally suggestecl that one miRNA could target multiple genes. and also several miRNAs could be orchestrated to downregulate a s pecific gene. However. there would be many possibilities to procluce more miRNAs and to target gene in more compli catecl manners tha n we expected Here‘ we developed a detection program of miRNA consensus sequences from non- cocling region of genetic corcls As the ha irpin structure 01' tRNA has step-loop like hybridi zation by a single strand RNA. the repeated 3-5 nt symmetric arrangement with 6- 12 nt spanning sequences for hail‘pin head is necessary to form a preCllrsor rruRNA The DNA base pair‘ polarity program symbolizecl by the electrostatic polarities of pyrimidine and purine is now reinforcecl by the cletection program fOI symmetric DNA strand from non-coding regions. For example, we iclentifi ecl candidate miRNAs targeting eIF5A mRNA (miR-eIF5A-l)‘ 288 ribosomal RNA (miR- 28S-1). and dentin sialophosphate protein mRNA (miR- D8PP-1). 1n t his study the detection methocl of 288 ribosomal RNA was demonstrated ancl the molecular biological effects 01' miRNA targeting in vitro culture system were evaluatecl by miRNA RT• PCR, Northen blot, siRNA interference, and in situ hybridization. We firstly sea rched the candidate miRNA from the intron sequences of each objectiγe gene using the programs of syrrunetric sequence cletection a ncl DNA base pair polarity, ancl secondarily siRNA procluced by in vitro transcription and inclucible lenti virus vector cons tru ction was transfectecl into HEK293 cells. The transfectecl siRNA of miR-28S-1 was accumulated in the nucleoli ancl inclllced apoptosis extens ively in 2 days cultur8. Northern blot using miR-288-1 probe showed strong reaction in t he 288 bancJ of total RNA and also showed a smeared band in small size representing the presence of t he precursor and mature miRNAs 이 miR-288-1. In in situ hyridi zation most of cells revealed intensive miR-288-1 positive reaction in their cytopl asms. mirni cking t he abllndant localization of 288 RNA From the above study. we presume that rniRNAs targeting s pecific genes are possibly derivecl from the in tron seq uences of the objective gene, and suggest that the symmetirc sequence detect ion ancl DNA base pair polarity program is useflll to define the candiclate miRNA
[n order to obtain the trlle expected DNA prod uct from PCR and RT-PCR using genornic DNA or cDNA reversely transcribed from mRNA. the PCR should be done in an appropriated condition. Sometimes the PCR was repeatedly fail ed. and cventllally the PCR product was turned out to be nonspecific and rudimentary . And more‘ t he PCR prodllctwas not reproducible even though careflll repeat of experiments. As the PCR was based on the exact primel hybridization. the condition of primer hybridization should be properly controlled by a nnealing temperatllre. But the selection of primer seqllences for targeting a specific gene is mostly important. A new method of primer eval uation is now available llsing DNA base pair polarity program. This study presents an example of PCR targeting to human Bax gene using genomic DNA. The DNA base pair polarity theory can di vide the genetic cord into propel DNA segments and calclllaLe their DNA base pair hybridization energy. Thus. mathematically the degree 0(' exact primer hybridization can be expected for the t r1l8 targeting of PCR. However, the DNA base pair polal'ityanalysis demonstrates that the more frequent number of DNA segment incl'eased the specificity of PCR. but decreased its sensitivity . While the greater polarity of DNA segment composed of increased nllmber of polarized DNA base pairs showed increased sensitivi ty 0 1' PCR. bllt relati vely decreased specificity of PCR. With the mllltiple analysis of PCR. especially for PCR cloning from the gDNA and cDNA, we found that the primers themselves showed secondary strllcture of partial hybridization between sameprimers or each pair primers. The DNA base pail‘ polarity signal can directly demonstrated symmetric sequences 0 1' each primer. and also can distinguish the dimmer formation from each pair primers. At least the symmetric seqllence of fOlll‘ base pairs dramatically showed the dimrner formation. On the other hand. in addi tion Lo the statlls of DNA base pair polarity the three-dimensional strllctllre of DNA dOllble helix targeted by the primer seqllences may affect the sensitivity and specificity of PCR detection. The present study introduced a new method of primer evalllation and selection in order to obtain abundant and exacL! y-trlle DNA product for genomic ffilltation analysis and gene expression profï le
Immuno-MemBlot is a technique for detecting, analyzing, and identifying proteins, similar to the Western blot technique but differing in that protein samples are not separated electrophoretically but are spotted through circular or slot templates directly onto the membrane. Recently we developed a new Immuno-MemBlot (IMB) method applying immunoreactions and coloring procedures directly in the wells of MemBlot apparatus, which were connected by canals to perform drainage for reagent application and buffer irrigation. This IMB method was designed to get theimmunoblot results more rapidly and clearly than the previous immunoblot ones. This study is aimed to evaluate the analytical accuracy of IMB using different biological assay. In the sensitivity test of IMB the monoclonal antibody can clearly detect the 30 ng (about 12 pM) of Mucocidin peptide (35 mer), and is also available to detect at least 10 ng (about 4 pM) of Mucocidin peptide (35 mer). The IMB was effective in the quantitative analysis of methothrexate (MTX) assay for cellular apoptosis. And more, this IMB is useful to screen large number of specific samples with ease and accuracy in a short time. In the screenings for the presence of Mucocidin in saliva the quantitative comparison is conspicuous among 48 persons depend on the different conditions ofgender, drinking and smoking habits, and oral diseases. Therefore, it is presumed that, even though the target proteins were partly degraded, a specific epitope can be detected if a monoclonal antibody was still reactive. Conclusively, these data suggest that the IMB can be useful in the primary qualitativeand quantitative analysis of proteins in various fluids, i.e., blood, saliva, tear, urine, etc.