본 연구는 S. aureus을 신속하게 검출할 수 있는 PCR primer를 개발하고자 실시되었다. S. aureus를 포함한 Clostridium, Escherichia, Salmonella, Shigella, Vibrio, Bifidobacteria, Lactobacillus, Streptococcus 등 그람 양성 및 그람 음성 균주 17 종의 genomic DNA를 대상으로 20종의 랜덤 primer들을 사용하여 PCR을 실시하였다. S. aureus의 특이적 밴드를 선발하여 DNA 염기 서열을 분석하였고 이를 바탕으로 5쌍의 primer를 제작하였으며 그 중 primer SYU-5를 사용하여 PCR을 실시할 경우, 단일 밴드로 나타나는 다른 균주들에 비해 S. aureus 균주에서 약 250, 550 및 850 bp 크기의 세 개 밴드들이 검출되었다. 또한, S. aureus가 첨가된 8종 균주들의 genomic DNA 혼합 용액과 각종 유제품 및 분쇄육을 대상으로 primer SYU-5의 특이적 검출능을 확인하였다. 본 연구에서 사용한 PCR 기법은 기존의 선택배지 배양법과 비교하여 시간 및 노동력 측면에서 식중독 유발 S. aureus의 검출에 보다 효과적인 방법으로 사용 가능하였다. 또한, 본 연구의 결과는 다양한 병원균들의 특이적 검출을 위한 PCR 기법 개발에 기초 자료를 제공할 수 있다.

본 연구에서는 식품 중 식물성 식품원료의 진위 판별을위하여 분자생물학적 기법을 이용한 판별법을 개발하였다.종 판별을 위한 유전자로 엽록체에 존재하는 matK 유전자와 핵 내에 존재하는 ITS 유전자 부분을 대상으로 하였으며, 가공식품에의 적용을 고려하여 PCR 산물의 크기는200bp 내외가 되도록 종 특이 프라이머(species-specificprimer)를 설계하였다. 대상종으로는 버섯류 6종(팽이버섯,표고버섯, 양송이버섯, 영지버섯, 새송이버섯 및 느타리버섯), 견과류 3종(밤, 잣 및 호두), 과실류 1종(대추), 채소류 6종(알로에, 미나리, 부추, 오이, 고추냉이 및 겨자), 콩류 2종(녹두, 팥) 및 기타 3종(과라나, 흰민들레 및 민들레), 총 21종을 선정하였으며, 종 특이 프라이머를 이용하여 예상되는 PCR 산물의 생성 유무를 확인하였다. PCR분석 결과, 21종의 식물성 식품원료에 대하여 각각 예상된 PCR 산물을 확인하였으며, 프라이머별로 비교종에서비 특이적 PCR 산물(non-specific PCR product)이 생성되지 않음을 확인하였다. 본 연구에서 개발된 종 특이 프라이머는 가열 및 가공된 식품 중 21종의 식물성 식품원료의 진위 판별에 이용될 것이며, 불량식품 근절에 적극 활용될 것으로 기대된다.

Using eight universal primers and new designed 315 species-specific primers, we tried to retrieve COI sequences from 45 dried specimens of 36 butterfly species collected from 1959 to 1980. The eight universal primers were entirely failed in PCR amplification and sequencing of all specimens. In the other hand, the 315 primers, targeting fragments of 71–417 bp, generated various lengths of COI sequences ranged from 444 bp to 658 bp from all specimens. Among 284 primer pairs, 26 primer pairs designed for Limenitis camilla, Argynnis niobe, and Brenthis daphne were success to produce COI sequences of congeneric speices, Limenitis doerriesi, Argynnis nerippe, and Brenthis ino. It suggests that the species-specific primers can be applied for analyzing COI sequences of closely related species. Our study reveals that newly designed species-specific primers will be effective to retrieval of COI sequences of old butterfly specimens.

In the gingival tissues of patients with periodontitis, inflammatory responses are mediated by a wide variety of genes. In this study, we screened for differentially expressed genes (DEGs) in periodontitis compared with normal tissue using an annealing control primer (ACP) system. By ACP RT-PCR analysis, we obtained about 160 amplicons, 8 of which were found to be differentially expressed. DEGs in patients with periodontitis were thus successfully and reliably identified by the ACP-based RT PCR technique. The DEGs identified in the screen may also enhance our understanding of the pathogenesis of periodontitis.

In order to determine an authenticity of food ingredient, we used DNA barcode method by universal primers. For identification of animal food ingredients, LCO1490/HCO2198 and VF2/FISH R2 designed for amplifying cytochrome c oxidase subunit1 (CO1) region and L14724/H15915 for cytochrome b (cyt b) region on mitochondrial DNA were used. Livestock (cow, pig, goat, sheep, a horse and deer) was amplified by LCO1490/HCO 2198, VF2/FISH R2 and L14724/H15915 primers. Poultry (chicken, duck, turkey and ostrich) was amplified by LCO1490/HCO 2198 and VF2/FISH R2 primers. But, Fishes (walleye pollack, herring, codfish, blue codfish, trout, tuna and rockfish) were only amplified by VF2/FISH R2 primers. For plant food ingredients, 3 types of primers (trnH/ psbA, rpoB 1F/4R and rbcL 1F/724R) have been used an intergenic spacer, a RNA polymerase beta subunit and a ribulose bisphosphate carboxylase region on plastid, respectively. Garlic, onion, radish, green tea and spinach were amplified by trnH/psbA, rpoB 1F/4R and rbcL 1F/724R. The PCR product sizes were same by rpoB 1F/4R and rbcL 1F/724R but, the PCR product size using trnH/psbA primer was different with others for plants each. We established PCR condition and universal primer selection for 17 item's raw materials for foods and determine base sequences aim to PCR products in this study. This study can apply to determine an authenticity of foods through making an comparison between databases and base sequences in gene bank. Therefore, DNA barcode method using universal primers can be a useful for species identification techniques not only raw materials but also processed foods that are difficult to analyze by chemical analysis.

In this study, a method was developed using molecular biological technique to distinguish an authenticity of meats for processed meat products. The genes for distinction of species about meats targeted at 12S or 16S genes in mitochondrial DNA and the species-specific primers were designed by that PCR products' size was around 200bp for applying to processed products. The target materials were 10 species of livestock products and it checked whether expected PCR products were created or not by electrophoresis after PCR using species-specific primers. The results of PCR for beef, pork, goat meat, mutton, venison, and horse meat were 131, 138, 168, 144, 191, and 142 bp each. The expected PCR products were confirmed at 281, 186, 174, and 238 bp for chicken, duck, turkeymeat, and ostrich. Also, non-specific PCR products were not detected in similar species by species-specific primers. The method using primers developed in this study confirm to be applicable for composite seasoning including beefs and processed meat products including pork and chicken. Therefore, this method may apply to distinguish an authenticity of meats for various processed products.

In the present study, we have used an annealing-control-primer (ACP)-based differentially display RT-PCR method to identify salt-stress-induced differentially expressed genes (DEGs) in barley leaves. Using 120 ACPs, a total of 11 up-regulated genes were identified and sequenced. Temporal expression patterns of some up-regulated DEGs in response to salt stress were further analyzed by Northern blot analysis. The possible roles of these identified genes are discussed within the context of their putative role in response to salt stress. Thus, the identification of some novel genes-such as SnRK1-type protein kinase; 17 kDa, class I, small heat shock protein; and RNase S-like protein precursor genes-may offer a new avenue for better understanding the salt stress response in plants, knowledge which might be helpful for developing future strategies.

We have previously shown that the larvae of swallowtail butterfly, Papilio xuthus, exhibit substantial antibacterial activity in the hemolymph, upon challenging with bacterial lipopolysaccharide (LPS). Here we report the isolation and molecular characterization of several immune inducible genes that are specifically expressed by employing annealing control primer (ACP)-based GeneFishing polymerase chain reaction (PCR) from P. xuthus the larva. Using 120 arbitrary ACPs, we identified 24 differentially expressed genes (DEGs) that are up-regulated in response to injected LPS. Sequence analysis showed that 18 DEGs revelaed a high sequence similarity to the previously characterized genes of other insects, although 6 DEGs showed no significant similarity to any known genes. Among these inducible transcripts we found 8 putative immune-related genes including cecropin and attacin. Finally, we analysed the expression profiles of potential immune-related genes by RT-PCR and found all of them were considerably increased in the mRNA levels by LPS injection.

Characteristics of polyaniline anti-corrosive coatings with various primer coating resins(epoxy resin, urethane resin, and others) and top coating resins(epoxy and acrylic urethane resins) were investigated through adhesion, acid resistance, alkaline resistance, water resistance, and anti-corrosion tests. As a result, the anti-corrosive properties of the prepared coatings using polyaniline varied with the types of primer and top coating resins. In this condition, the properties of adhesion, chemical resistance, and water resistance were found to be very satisfactory when using emeraldine base (EB) of polyaniline blended with single-packaged urethane and acrylic urethane resins as the primer coatings, and using acrylic urethane resin as the top coatings. Also, the anti-corrosive function of these anti-corrosive coatings was well preserved for 1000 hr in the salt spray experiment.

Al thou gh it was reported that the human genome had been entirely seq uenced. so far there frequently appeared non - redundant cDNAs in gene cloning of cellular mRNAs. Consequently a lot of effort is required to ide ntified the new genes for theil‘ localization in chromosome and their functlons If the new genes had small size sequences 0 1' were expressed in low level , 5' RACE became ha rd unexpectedly. Here. we demonstrated a new method of 5’ RACE by PCR cloning using hair pin prime r and cDNA template produced by gene specific primer. Firstly .. total RNA obtained from tissue 0 1' cells is primed for rever se transcri ption (Superscript lI) by antisense primer (AS-l) specilïc to the objective gen e in order to produce single strand cDNAs The cDNAs usua lly have 3' overhanging of CCC seq uence. SeconcUy, a hail‘ pin primer overhang GGG seq uence in 3' end (i .e ‘ Tn'AGTGAGGGTTA AGAAGGAGAATTAACCCTCACTAAAGGG) is rnixed with the cDNA produced above, and 1'01- lowed by heating at 70'C for 5 min and cooled in room temperature to make hairpin-end template cDNAs Thirdly, For PCR is performed using the ha irpin-end template cDNAs and primer set of inner hairpin sense primer (i . e., TAACCCTCACTA AAGGGG) and AS-1 using pfu polymerase. And next. the PCR product can be directly sequenced 0 1' subcloned into vector to seq uence the purified plasrnid DNA. In our laboratory several unidentified new genes have been under investigation for theil‘ genomic l oci and functions. However. one of them. a human short helical protein 1 (hSHP-1) was a short gene less than 600 bp in s ize. encoding 45 amino acids . hSHP-1 is able to produce a potent antimicrobial peptide which has similar strength to magainin from frogs. The hSHP-1 also showed multifunctional roles of innate imrnunity including not only the ant imicrobial activity against methi cillin resistant strains but a lso anti- neoplastic effect on precance rous cell s . Fluorescence in situ hybricli zation in chromosome was not successful due to weak signal. and genornic Southern of hSHP-l showecl a higher weak bancl. which is not clearly definecl as an comrnon genomic locus‘ but could be cons idered its or igin from centromere region which contains less frequent restri ction sites. And more, th e ordinary PCR cloning performed pre vious ly from human genornic DNA produced only repetitive non-specific DNAs which were not matched to hSHP-l cDNA This study demonstrated how we have don e the PCR cl oning usi ng ha irpin primer and cDNA template reve rsely transcribed by gene specific primer.

[n order to obtain the trlle expected DNA prod uct from PCR and RT-PCR using genornic DNA or cDNA reversely transcribed from mRNA. the PCR should be done in an appropriated condition. Sometimes the PCR was repeatedly fail ed. and cventllally the PCR product was turned out to be nonspecific and rudimentary . And more‘ t he PCR prodllctwas not reproducible even though careflll repeat of experiments. As the PCR was based on the exact primel hybridization. the condition of primer hybridization should be properly controlled by a nnealing temperatllre. But the selection of primer seqllences for targeting a specific gene is mostly important. A new method of primer eval uation is now available llsing DNA base pair polarity program. This study presents an example of PCR targeting to human Bax gene using genomic DNA. The DNA base pair polarity theory can di vide the genetic cord into propel DNA segments and calclllaLe their DNA base pair hybridization energy. Thus. mathematically the degree 0(' exact primer hybridization can be expected for the t r1l8 targeting of PCR. However, the DNA base pair polal'ityanalysis demonstrates that the more frequent number of DNA segment incl'eased the specificity of PCR. but decreased its sensitivity . While the greater polarity of DNA segment composed of increased nllmber of polarized DNA base pairs showed increased sensitivi ty 0 1' PCR. bllt relati vely decreased specificity of PCR. With the mllltiple analysis of PCR. especially for PCR cloning from the gDNA and cDNA, we found that the primers themselves showed secondary strllcture of partial hybridization between sameprimers or each pair primers. The DNA base pail‘ polarity signal can directly demonstrated symmetric sequences 0 1' each primer. and also can distinguish the dimmer formation from each pair primers. At least the symmetric seqllence of fOlll‘ base pairs dramatically showed the dimrner formation. On the other hand. in addi tion Lo the statlls of DNA base pair polarity the three-dimensional strllctllre of DNA dOllble helix targeted by the primer seqllences may affect the sensitivity and specificity of PCR detection. The present study introduced a new method of primer evalllation and selection in order to obtain abundant and exacL! y-trlle DNA product for genomic ffilltation analysis and gene expression profï le

RAPD 분석은 한 개의 primer를 이용하여 임의의 DNA조각을 증폭하는 것이다. 이 때 만들어지는 여러 형태의 DNA band유형을 이용하여 살모넬라를 분류할 수 있다. 살모넬라를 효과적으로 RAPD typing할 수 있는 sprimer들을 엄선하기 위하여 살모넬라 표준균주 16종을 대상으로 총 20가지 primer들의 RAPD 분리력을 비교하여 보았다. 결과는 재현성이 높았으며 이중 primer A, OPG04, OPG10, OPL-03은 16가지 균 모두를 다른 유형으로 분리하였고 primer OPB-17, OPB-6, OPG08, OPL-02는 15가지 유형으로 분리하였다. 이들은 discrimination index, band의 숫자, band scoring의 난이도 등을 고려해 볼 때 나머지 primer 들에 비해 우수한 분리력을 보였다. 이들 primer들은 장차 살모넬라의 RAPD typing에 이용될 수 있을 것으로 보이며, 현재는 이들을 이용하여 돈육 공장의 오염원 규명을 위한 연구를 수행 중이다.

RAPD 분석은 한 개의 primer를 이용하여 임의의 DNA조각을 증폭하는 것이다. 이때 만들어지는 여러 형태의 DNA pattern을 이용하여 리스테리아 모노사이토제네스를 분류할 수 있다. 리스테리아균들을 효과적으로 RAPD typing 할 수 있는 primer들을 엄선하기 위하여 리스테리아 표준균주 13종을 대상으로 총 31가지 primer들의 RAPD분리력을 비교하여 보았다 결과는 재현성이 높았으며 이중 6가지 primer(primer 6, HLWL74, UBC155, UBC127, Lis5, Lisll)가 discrimination index, band의 숫자, band scoring의 난이도 등을 고려해 볼 때 나머지 primer 들에 비해 우수한 분리력을 보였다. 이들 primer들은 장차 리스테리아의 RAPD typing에 이용될 수 있을 것으로 보이며, 현재는 이들을 이용하여 돈육공장의 오염원 규명을 위한 연구를 수행 중이다

본 연구에서 FPC에 사용되는 동박과 접착제의 이종 재료간에 계면접착력을 향상시키기 위해 silane primer를 도입하였다. 또한 동박표면 및 에폭시 접착제를 개질하여 개질조건이 접착강도에 미치는 영향도 조사하였다. 본 실험은 접착제층과의 상용성을 고려하여 silane primer로 triethoxyvinylsilane을 용액 및 무유화제 유화중합한 고분자형태와 3-aminopropyl-triethoxysilane (3-APTES), 3-glycidoxypropylmethoxysilane (3-GPTMS)을 사용하여 접착제층과의 접착력 증진을 도모하였다. 동박표면은 1,1,1-trichloroethane을 사용하여 개질 시간에 따른 동박 표면의 지형변화와 그에 따른 접착강도를 조사하였다. 결과에 따르면 silane을 사용한 경우 동박-접착제간의 접착력이 약2 ~ 5배 정도 증진되었고, 동박표면의 개질시간은 약 10분 정도가 최적의 접착조건임을 알 수 있었다. 또한 저분자량 실란의 농도에 따른 접착력은 3-APTES는 약 0.5 vol.%에서 최고 접착력을 보였고, 3-GPTMS의 경우 약 0.2 vol.%에서 최고의 접착력을 보였다.

RAPD-PCR(Random Amplified Polymorphic DNAs-Polymerase Chain Reation) 기법에 누에의 유전적 변이 분석을 위한 첫 단계로 다양한 GC함량을 갖는 random primer에 의해서 증폭되는 DNA 단편의 양상 및 증폭도를 비교하였다. RAPD-PCR을 위한 random primer의 증폭도는 GC함량에 의해서 상당히 영향을 받음이 분석되었다. 특히, 50% GC 함량을 갖는 primer는 그 증폭도에 따라서 4가지의 그룹으로 DNA단편이 증폭되었으며 〔bad amplification (75.5%), poor amplification (11.1%), good and excellent amplification(11.1%)〕, primer의 GC 함량이 증가할수록, 휠씬 더 좋은 증폭도를 보여주었다. 그러나, 40% GC 함량을 갖는 primer에 의해서는 어떤 증폭산물도 관찰되지 않았다. PCR을 수행하기 전에 6가지의 제한효소(BamHI, HindIII, Xbal, HaeIII, MspI, Rsal)를 사용하여 누에 genomic DNA를 처리하여 이를 주형 DNA로 하여 RAPD-PCR을 수행한 결과, 유전적 마커의 생산에 대한 효율이 증가함을 알 수 있었다. 이상의 결과를 종합해 볼 때 60%이상의 GC함량을 갖는 random primer와 전처리한 주형 DNA의 사용은 여러 가지 다른 누에 계통의 동정 및 연관군 지도작성에 따른 경비 및 시간을 줄이는데 효율적이라고 사료된다.