In t his study, we tried to identify the key elements that respond to EGCG t reatment and its role in cell survival 0 1' apop tosis by EGCG. focusing on Akt pathway and Raf-MEK-ERK pathways. Cells were serum starved for 16 h and then treated with (-) -epiga llocatechin-3-gallate. To cletermine which pathway is related to effects of EGCG on cell s, the levels of phosphorylated Akt(pAkt) and Erk (pErk) were a nalyzed by immunoblotting. A549 cell s showed the increase of pAkt in response to EGCG‘ whereas Hela cells exhi bited no difference in the levels of pAkt by EGCG treatment Phos phorylation of Akt over initial basal levels became evident a fter 1 h of EGCG treatment and peaked at 3 h pErk was also increased by EGCG in Hela cells as well as in A549 cells To determine th e effect of EGCG on growth of cells‘ A549 cells were treated wi th vari 。u s concentrations of EGCG (from 10 μ M to 300 μ M) for 3 h. Cell growth was examined by MTI assay. The resulting growth curves of A549 cell s showed that EGCG promotecl cell prolifera tion in a close-dependent manner at early phase. When cells were t rea ted with EGCG for 24 h. pAkt and pErk expressions were significantly i띠1ibited , even at 10 μ M B-raf ex pression was also clecreased in a close-dependent manner. In teresti ngly. the presence of serum weakened t his inhibitory effect of EGCG on the ex pression of survival facto rs. Our study inrucates that EGCG stimulates cell survival of A549 cells through thc PI3K/AKT pathway. though it fina lly be haves like a suppressive agent on cell su rvival
Al thou gh it was reported that the human genome had been entirely seq uenced. so far there frequently appeared non - redundant cDNAs in gene cloning of cellular mRNAs. Consequently a lot of effort is required to ide ntified the new genes for theil‘ localization in chromosome and their functlons If the new genes had small size sequences 0 1' were expressed in low level , 5' RACE became ha rd unexpectedly. Here. we demonstrated a new method of 5’ RACE by PCR cloning using hair pin prime r and cDNA template produced by gene specific primer. Firstly .. total RNA obtained from tissue 0 1' cells is primed for rever se transcri ption (Superscript lI) by antisense primer (AS-l) specilïc to the objective gen e in order to produce single strand cDNAs The cDNAs usua lly have 3' overhanging of CCC seq uence. SeconcUy, a hail‘ pin primer overhang GGG seq uence in 3' end (i .e ‘ Tn'AGTGAGGGTTA AGAAGGAGAATTAACCCTCACTAAAGGG) is rnixed with the cDNA produced above, and 1'01- lowed by heating at 70'C for 5 min and cooled in room temperature to make hairpin-end template cDNAs Thirdly, For PCR is performed using the ha irpin-end template cDNAs and primer set of inner hairpin sense primer (i . e., TAACCCTCACTA AAGGGG) and AS-1 using pfu polymerase. And next. the PCR product can be directly sequenced 0 1' subcloned into vector to seq uence the purified plasrnid DNA. In our laboratory several unidentified new genes have been under investigation for theil‘ genomic l oci and functions. However. one of them. a human short helical protein 1 (hSHP-1) was a short gene less than 600 bp in s ize. encoding 45 amino acids . hSHP-1 is able to produce a potent antimicrobial peptide which has similar strength to magainin from frogs. The hSHP-1 also showed multifunctional roles of innate imrnunity including not only the ant imicrobial activity against methi cillin resistant strains but a lso anti- neoplastic effect on precance rous cell s . Fluorescence in situ hybricli zation in chromosome was not successful due to weak signal. and genornic Southern of hSHP-l showecl a higher weak bancl. which is not clearly definecl as an comrnon genomic locus‘ but could be cons idered its or igin from centromere region which contains less frequent restri ction sites. And more, th e ordinary PCR cloning performed pre vious ly from human genornic DNA produced only repetitive non-specific DNAs which were not matched to hSHP-l cDNA This study demonstrated how we have don e the PCR cl oning usi ng ha irpin primer and cDNA template reve rsely transcribed by gene specific primer.
Cancer cure and survival rate related directly to the stage of the cancer at the time of diagnosis. New techniques fOl ea rly screen system and diagnosis of normal and cancer a re required. Here, we investigate optical properties-based optical s igna tures of normal and cancer tissues that are different chemica lly and physically. At least 7 cases of each tissue type‘ including epidermis. dermis . subcutaneous fat. keratin pearl ‘ muscle, bone. skin. normal and cance r. were measured. As a result. difference in absorption, transmi ssion and reflectance of normal and cancer in oral tissue have the potential to pro vide for cancer screening. In particular. measuring transrnission in 400 nm to 800 nm (inclusive of 450 nmfor NADH. 540 nm 1'0 1' collagen) ‘ t his group noted a difference in auto-fluorescence spectra between normal and cancer specimens . We also noted that normal specimens are cha racterized by a slightly higher reflectance than cancer specimens in the 400 to 800nm And a bsorpt ion of normal is lower than cancer specimens. The diffe rences in transmission. refl ectance and absorpti on between normal and cancer s pecimens were statistically analyzed using student t-test. [n t his study. absor ption. t ransmi ssion and reflectance have been suggested as optimal for best discrirnination between normal and oral cancer specimen. We suggest that a optical integrating sphere is a useful tool for cancer sc reening. The results suggests the potentia l of an effec tive diagnosis system and accurate normal and cancerous tissue's optical coeffi cient
Wntsignaling is involved in the normal development and tumorigenesis via epithelial- mesenchymal transition (EMT). init iated by down-regul ation of E-cadherin by the transc ription factor Snail. Wnt signaling inhi bits Sna il phosph o rylation t hrough Axin2-dependent pathway that sustains nuclear accumul ation 0 1' Snail by driving CSK3ß nucleocytoplasmic export then consequently increases Snail protein levels and induces an EMT However. the roles of Wnt and Axin expression and their functional implication on Snail dependent EMT program a re not clear du ring the multistep carcinogenic process. We examined that canonical Wnt signaling engagingmul t istep carcinogenic process of uterine cervical cancer through Wnt-Axin2-Snail axis. In nonnal cervi cal mucosa, Wntl. Wnt3a. and Axin2 mRNA expression were locali zed in basal cell layer suggesting that canonical Wnt is required for maintenance of self-renewal program of cervica l epi theli al cells. With progression to cervical int r aepithelial neoplasia (CIN) and carcinoma. Wntl, Wnt3a‘ Axin2, and Snail expression were gradually increased in patient samples suggesting that canonical Wnt pathway is involved in earl y step of carcinogenesis in uterine cervix. LRP6 and Axin2 transfected cells showed the highly increased nuclear Snai l resul ted from dec reased level 0 1' nu clear GSK3ß , indicating that LRP6- Axin2 serves to stabili ze Sna il protein levels and susLains iLs nllclear acc llrnulation by driv ing GSK3ß . RNA interference of Axin2 and Snail on SiHa cells relieved E-cadherin proximal promotel‘ activity and block the in 띠 vo chorioalantoic membra ne ln VaSlOn These results suggest the canon ical Wnt signa ling regul ating Axin2-GSK3ß compartmentalization may important for stabi li zation of E- cad herin repressor Snail during the multistep carcinogen ic process of uteri ne cervix. It may lead to not only tracing the proper biomarker 0 [' ca ncer progression‘ but a lso the development oJ new targets for therapeutic intervention in cancer
1,1- Bis(3’-indolyl)-l-(p-methoxyphenyl)methane (DIM- C- pPhOCH.3) is a methylenc - substituted diindolylmethanes (C-DIM) ana log that acti vates the orphan receptOl‘ nerve growth factor-induced-B (NGFI-B, Nur77) , RNA inteference studies with small inhibitory RNA for Nur77 demonstrate that DIM-C-pPhOCH:J induces Nur77-dependent and - independent apoptosis, and this study has focused on delineating the Nur77-independent proapoptotic pathways induced by the C-DIM analog DIM-C-pPhOCH3 induced caspase-dependent apoptosis in RKO colon cancer cells through decreased mitochondrial membrane potential which is accompanied by increased mitochondrial bax/bcl-2 ratios and release of cytochrome c into the cytosol DlM-C一pPhOCH.3 also induced phosphatidylinositol-3-kinase-dependent activation of early growth response gene-l whi ch, in turn, induced expression of the proapoptotic nonsteroidal anti-inflammatory drug- activated gene-l (NAG- l) in colon tumors in athyrnic nude mice bearing RKO cells as xenografts, DIM-C-pPhOCH.3 also activated the extrinsic apoptosis pathway through increased phosphorylation of c- jun N-terminal kinase which, in turn, activated C/EBP homologous transcription factor (CHOP) and death receptor 5 (DR5) , Thus, the effectiveness of DIM-C-pPhOCH.3 as a tumor growth inhibitor is through activation of Nur77-dependent and -independent pathways
PDT is an established cancer treatment modality, This can be attri buted to the attractive basic concept of PDT; the combination 0 1' two therapeutic agents , a photosensiti zing drug and light, which are relatively harmless by themselves but combined ultimately cause more 0 1' less selective tumor destruction, The bacteri ochlorophyll - derivatived photosensitizer s are known to be s tabl e and highly effïcient, ln thí s study, we conducted a seríes of experiments to develope the light induced anticancer drugs against oral cancer cell , We tested the cytotoxi city of the hydroxybacteriochlorine by MTT assay and observed the cell death pattern(apoptosis or necrosis) after PDT by hoechst 33342 and propidium iodide s taining methods, lC50 value of the hydroxybac teriochlorine was 3 1 , 3 ng/ n띠, At higher doses of hydroxybacteriochlori ne () 60ng/ rnQ) , cancer cells died exclus ively by necrosis after PDT By contrast, at lC50 value, hydroxybacteri ochlorine induced cancer cell to undergo apop totic c e ll death, The induct ion begins approximately 6 hours a fter PDT, We inves tigates intrace l1 ular localization of hydroxybacte riochlorine by oral cancel‘ cell via confocal laser scanning mi croscopy, Oral cancer cells dua l-stained with hydrox ybacteriochlo1' ine and organelle-specific flu orescence probes (Mi totracker , Lysotracke1', ER- Tracker) revealed an intracellular f1 uores c ence dis tribution restricted to cyt oplasmic compartments with no det ectable fluorescence in the nucleus, Confocal im ages of cells containing hydroxybacte1'iochl orine were never overla p to mitochondria, lysosome . endoplasmic reticulum when digita lly overla pped with tqe organel1e-specific f1 uorescence p1'obe images o{' the same cells These results demons trated tha t the hydroxybacte1' iochlorine may have a fun ction as a photosensitizer and cytotoxicity hydroxy bacteriochlo1'ine for o1'al cancer cell is more sensitive than head & neck cancer cell 0 1' ce1'vical cancer cell Therefore PDT using hydroxybacte1'iochl orine is suita ble treatment for oral cavity carcinoma patients
Photodynamic therapy (PDT) is a clinically approved and ra pidly developing cancer treatment regimen, It is a minimally invasive procedure that requires the administration of a photosens iti zer foll owed by the illumination of the tumor with Iigh t of an appropriate wavelength, In the presence of molecular oxygen, cytotoxic intermedi a ries a re produced‘ thus damaging cellular structures containing the photosensitizer , In the present study. we exa mined the effectiveness of newly d evelped chlorin e6- induced PDT on malignant animal tumor model of 3prague-Da wley (3D) ra t Three-week-old male 3D rats we re inocula ted s ,c, on the right f1 ank with our previously esta blished k- ras-trans formed RK3E cell line (RK3E- ras. tota l, 5xl07 cell s) , The experiments were carried out 1 week after inoculation of tumor cell s , by which time the tumors had r eached about 0,7 mm to 1.0 cm in diameter, L3-chlorin e6 (L8 Pharm Co" Gwa ngju, Korea) was admin istrated intravenous ly by the tail vein of 3D rat at a dosage of 10 mg/kg after inhalation a nesthesia of ether, Twenty- four hours a fter L8-chlorin e6 ad ministration, PDT was pe rfol‘med using a laser diode (Geumgwang Co ‘ Ltd‘’ Daejeon, Korea) a t a light dose of 100 J /cm2 and wavelength of 664 nm, A..nimals were monitered daily and tumor volume was measured by calipel The tumor t reated with PDT using Ce6 had significant reduction in tumor s ize examined by gross tumor volume , softex x- ray image, molecular imaging a nalysis, respectively, PCNA immunostaining and TUNEL assay revealed that the treat ed tu mor caused signifi cant inlübition of tumor formati on with decreased tumor cell proliferation a nd increased a poptosis , Our dat a showed Ce6-induced PDT effecti vely arrested the tumor growth by inhibi t ing cell proliferation a nd inducing a poptosis , These findings provide the potential value of Ce6- induced PDT as an a lternative candidate for a nt i- tumor therapy, Furthel bi ochemical and cellular studies will reveal the precise molecul ar mecha ni sm of cell death induced by PDT
The characteristic of implant s llrface is the most i mportant factor in osseointegra t ion procesR , Prol i fera tion and rli ffel' entiat ion of osteoblast, a nd local factors concerning bone forma tion a l'e inflllenced by sUl' face cha racteri s tic and it al so con t l'ols bone reactlOn The purpose of this reseal'ch was to s tlldy a boll t ini t ial adhesion. prolife ration and acti vation of osteo blast to titanium surface treated wi th mac hined‘ hydroxyapat ite coating, resorba ble blast materi al blasting and a n odi zing method To attach and culture osteobl ast‘ titanium cylinder block wi th 5mm in di ameter and 5mm in height was mad e , After t l'eating the titanium surface of each bl ock with machined, hydroxyapatite coating, I'esorhable blast ma teri al blasting and anodi zed coating, i.mpllrities wel'e I'emoved and stenllzed The number of cells attached from cultul'ed osteobl ast of I'espective expel’imental groups were measured at 1, 4, 7. and 14day, Al ka line phosphatase, calcium. and inorganic phosphate concen tra ti on 0 1' cultured solution was measul'ed, Anodi zing group showed the hi ghest. and RBM treated grollp was foll owed, Machined grollp was the worst ra te of cell a ttachment and pl 미 ife ra ti o n activity, RBM t l'eated grollp s howed the high est in creasi ng on theil‘ alkaline phosphatase activi ty of 1 and " days in cultllred osteobJast to compnrc wi th othcr groups. Thc rc was no significant differe nce among other grollps , stati stically, RBM trea ted grollp showed the hi ghest rate 0 1' increa s ing on the ca lcillm apposition of 1 a nd 4 days in cllltured osteobl ast to compa re wi th other groups , The re was no s ignificant differ ence among other groups ‘ statistica lly, RBM t reated g roup showed the highest rate of inorganic phospha te apposi t ion to compare with other groups , The re was no s ignifi cant diffe rence among other groups‘ s tati stically, It suggested tha t surface modi fï cation of titani um would be profoundly effected on the attachment. proliferation and activation 0 1' osteoblast in init ial stage osseolll tegrat lOn
We evaluated the influence of internal macro- porous structure on tissue-engineered bone regeneration by cOll1paring the effi cien cy of scaffold-cell construct forll1ation and its bone induction activity. T매o types of macro-porous CMP cera rnic blocks having 400 um average pore s ize in an interconnected trabecular framework and interconnected globular structu1'e with small fenestrations were prepa1'ed, adopting sponge method and foaming method. respectively. They ware evaluated by cytotoxicity. cell ular attachment. and t heir differenti ation in vitro and the histocompatibility, osteoconductivity, and ectopic osteoinductive potenetial in vivo, respecti vely. Both scaffolds having either interconnected trabecu lar pOI‘es formed by sponge ll1ethod 0 1' fully interconnected globu lar pores formed by foam-based technology were no cyt otoxic and induced neither an immune nor an infl ammatory response regardless 0 1' geometry and manufacturing methods. The fu lly interconnected globul 81 porous scaffold showed more favora ble compression strength compared to the interconnected trabecualr porous scaffold (8.7 :tO. 5 MPa va 5. 5:t0. 5 MPa) . The increased surface in fully interconnected globular po1'ous scaffold facilitated osteogenic repall‘ by favored cellular attachment and osteogenic differentiation with good osteoconductivity. These results suggest that the fully interconnected globular porous structure be more sui table for both bone s ubstit ute and scaffold for t issue-engineered bone regeneration‘
Nowdays, implant treatment became a branch of universal dental treatment and results in mOI‘ e success by surface con dit ioning and continuous improvements. Recently, a method to extract crystal shows sirnilar Ca/P ratio as HA has introduced which is anodizing electrolyte pure titanium anodize by electrolyte ß -glycerophosphate disodium salt hydrate and calcium acetic acid on pure t itanium before hydrothermal treatment ln t his study fixu res have divided in 3 group: Machined(Group 1), Anodized(Group 1I), implant whi ch has a surface containing Ca and P formed by anodization and hyd rothermal treatment( Group m). Total 18 fixtures were impla nted on rabbit which sacrifi ced on week 2 and week 4 for the histological specimens. By t hese specimens polarized microscopic view‘ ll1icro CT view‘ EPMA, ISQ value were ll1easured, cOll1pa red and a nalysed by each group to f igure out the possible clinical use of titanium implant containing Ca and P by hydrothe rll1al treatment and anodizing electrolyte. ISQ value had no s ignifïcance differences between each 3 groups, However in each group 4 , 8 weeks had hi gher ISQ value than 2 weeks 1n polarized rni croscope, calcification level was following Group 1I ‘ Group m, Group 1. 1n rnicro CT‘ formation of cancellous bone level was following ‘ Group 1I , Group m, Group 1. 1n EPMA, distribution and concentration of Ca was following : Group 1I was two t ill1es more higher than Group 1 , Group m. Group m were higher level t han Group 1. In distribution and concentration of P Group 1I was high er than the other group. but th e re were no statical s ignifi cances. Finally, anodi zed implant was the most exellent on the early bone for ll1a tion Containing Ca and P implant by anodizing and hydrotherma l treatment was more better than machined surface implant, but there is no effi cience at ear ly bone formati on
1'0 develop an effi cient scaffold fo1' t issue-engineered bone 1'egene1'ation, we evaluated fully in terconnected globular porous bisphasic calcium-phosphate ceramics. Materials and Methods: Biphasic HA/TCP cera mic scaffolds having f띠 l y interconnected globular structure with small fenestrations adopting foaming method were p1'epared. They were evaluated by cytotoxici ty‘ cellular attachment. and theil‘ differentiation in vitro and the hi s tocompatibili ty, osteoconductivity. and ectopic os teoinductive capacity in 띠 vo , respectively. They have average 400um s ized spherical pores and ave1'age 100um s ized inter connecting interpores with average 85% porosity. They r evealed comparable compression strength with cancellous bone. They were nontoxic and revealed no noxious effect on cellular proliferation and osteoblastic diffe re ntiation. The cul tured cells on scaffolds were well attacbed and proliferated in multi-layers. The increased surface in fully interconnected globular porous scaffold facilitated osteogenic repair by favored cell ular attachment and osteogenic differentia tion with good osteoconductivity. 1n addition. the scaffold-cell constructs induced favorable ectopic bone formati on These findings suggest that the fully interconnected globular porous biphas ic HA/ß -TCP ceramic scaffold formed by foaming method can be a promising bone substitute and a scaffold fo 1' tissue-engineered bone 1'egeneration
사람의 타액선 종양 중 선양닝성암종(adenoid cystic carcinoma) 과 기저세포선암종(basal cell adenocarcinoma)‘ 기저세포선종(basa l cell adenoma) 은 발생학적 기원과 조직학적 소견 등 비슷한 점이 많으나 선양낭성암종은 5년 이후의 생존율이 매우 낮으며 기저세포신 암종은 저 등급의 악성도를 보이는 둥 임상적인 면에서 많은 차이를 보인다 이 연구에서는 조직병리학적으로 비 슷한 소견을 보이는 이 들 타액선 종OJ을 대상으로 이 형접합성 소실 (Loss of Heterozygosity. LOH) 을 분석하여 종양의 발생학적 기전을 파악하고자 히 였다 띤 구 방법으로는 기저세포선 종 4 예 기저세포선암종 5 예 선양낭성암종 30예에서 종양 상피세포의 유전자 변이 분석을 위해 레이저 포획 미세 절제법 (laser capture microdissection) 을 이용하여 조직에서 각각 종양 상피세포를 채취하였다 이 조직에서 각각 DNA를 추출한 후 11 쌍의 현미부수체 불안정성 표지 자(Mi crosatellite instability marker) 를 사용하여 PCR 반응을 시행하였고 이 산물을 8% p이 y acrylamide gel 애 1시간 30분간 전기 영동하여 종양 상피세포의 이형접합성상실의 양상을 판독한 후 SPSS 1400을 사용하여 통계학적 으로 분석하였다 연구 결과 모든 조직에서 종양 상피 세포의 LOH가 나타났으며 11개 표지자 중 LOH가 말현되지 않은 표지자는 없었 다 기저세포선종, 기저세포선암종‘ 선양낭성암종의 LOH 발생 빈도는 기저세포선종과 기저세포신암종과 비교하여 선양낭성암종에서 통 계학적으로 유의하게 높았으며 21번 염색체와 8번 염색체에서 차이를 보였다- 이 중 D21S1922와 D9S171 표지자에서 특히 높은 빈도 차 이 를 보였다. 기저세포선종과 기저세포선암종을 비교하였 을 때 전체 표지자에서 LOH 빈도 차이는 없었으나 21번 염색체와 9 번 염색체에 서 기저세포선암종의 LOH 빈도가 높게 나타났다 3종류의 티액선 종양에서 선양냥성암종에서 D9S168의 발생 빈도가 가장 많았다 D9S168은 기저세포선종에서 는 LOH가 나타나지 않았으나 기저세포선암종 선양낭성암종의 경우 발현 빈도가 통계학적으로 유의하게 증 가하여 종양 발생 과정에 관여하고 있음을 시사하였다
암 발생 이 후, 암세포외 섬유모세포는 cytokine. 성장인자 둥 분자를 통하여 상호 작용을 일으킨다 최근 cbemokines의 신호전달이 종양세 포와 기질 미세환경의 상호작용에서 암세포의 성장, 침윤, 이 동애 중요한 영향을 준다고 보고 되였다 본 연구에서 마이크로 어레 이 를 통하여 구강펀평 세 포암종 암세포외 구강편평 세 포암종 암조직에서 유래된 섬유모세포의 공동배양에서 섬유모세포 존재할 경우 구강 편평세포암종 세 포주애서 chemokine receptor를 포함한 다수의 유전자들이 발현이 증가되었으며, 또한 암세포가 존재할 경우 섬유아세 포에서 는 c h e mokines을 비 롯한 디수의 cytokine 유선자들의 발현이 증가 되였음을 알게 되었다. 암세포와 섬유모세포사이의 상호 작용 에서 영힘을 주는 chemokin않의 종류 및 역할을 진일보 분석 하였다 구강편평세포암종 (OSCC) 세포주 YD-lOB, YD• 38, HSC-2, HSC-3, Ca9-22 빛 구강편평 세 포암종에서 유래힌 섬유모새포 (cancer derived fibroblast; CF) 를 사용하였다, 마이크로 어레이와 re al- time PCR를 통하여 암세포외 CF의 공동배양에서 발현에 변화가 존재하는 chemokines과 cbemokine receptor를 분석하였고, Trans well assay와 wound hea ling assay을 시행하여 CCL7의 암세포 침윤에 미치는 역할을 검토하였고‘ F-actin 형광염색으로 암세 포 세포 골격의 액틴세사의 활성을 형태학적으로 관찰하였다 또한 ELTSA를 이용하여 CCL7 분비량 측정 및 발현대상을 확인하였으며 면역조직화희염색으로 구강편평세포암종 조직 에서 CCL7의 발현 을 조사하였다 암세포와 섬유모세포의 공동배양에서 CF 존재 시 암세포 에서 ch emokine recep tor를 포함한 다수의 유전자‘ CCR5. CEECAM1 동의 발헌이 증가되었으며. 또한 암세포와의 공동배양에 의해 CF 에서는 암세포가 존재 시 CCL7‘ CXCL1, CXCL3 등의 c h emokines의 발현이 증가 되었다 특히 HSC-2, YD-IOB‘ Ca9-22 OSCC 암세 포와 CF의 공동배양에서 CF의 CCL7의 발현이 증기히였다 Trans well assay와 wound healing assay 실험에서 CCL7를 처리한 OSCC 세포의 이 동은 농도 의존적으로 농도 증가에 따라 증가하였으며 a nti -CCL7에 의하여 억제 되었다 F-actin 형광염색에서 CCL7 침가에 의해 농도 의존적으로 암세포 세 포 골격 의 액틴세사의 활성을 나티내어 세포돌기가 증가도어 이동성 증가를 형태학적으로 확인하였다 CF와 구강암세포(YD- 10B, HSC-2. HSC-3‘ Ca922‘ YD- 38) 와의 공동 배양에서 CCL7 의 발현은 모두 증가 되었고 CCL7의 발현은 CF 에서 분비 되였음을 확인하였다 정상 치 은 조직 9건 OSCC 암환자의 조직 16건에 대하여 조직면역화학염색을 진행한 결과 암환자의 조 직애서 7 례 (43%) 에서 CCL7 말현 을 관칠하였다 구강편평 세 포암종 암세포의 침윤은 암세포 자극에 의해 섬유모세포가 활성화 되어 CCL7의 분비를 촉진하고 섬유모세포에 의하여 분 비된 CCL7은 암세포에 영향을 주어 암세포로 하여 금 세 포골격 의 변화를 일으키며 이는 세포이동을 촉진하여 암세포의 침윤을 유도함을 알 수 있었다‘
Recently, new antibacteri al strategy has been demanded because of the incr eased occurrence 0 1' drug-resistant bact ena Accordingly , phot odynarnic therapy has been attempted for clinical appli cation against drug-resistant bact eri a, Antimi crobial photodyna rni c t herapy combines a nontoxic photosensiti zer with harmJ ess vi sible light to generate singlet oxygen and free radicals that kill lni croor ganism. In thi s study , we investigated bactericida l effect of photodynarnic ther apy by using phot osensiti zer chl orin e6 to pathogenic bacteria including a gram- positive Stapbylococuus a ureus and gram- negative strains including Pseudomonas aeruginosa, EscbeJicbia coù; and SaJmoneJla en terica sero v,없' 7γpbimurium, To exa때 n e antimicrobial ef fec t 0 1' photodynamic t herapy, we measured inhibition zone‘ colony forrning units (CFU) , and in situ viability of bacteri al cell s after illumination with an energy density (Diode pumped laser driver LD203이 01 20J/cm2 in the presence 0 1' lOuM chlorin e6, We found the incr ease 0 1' inhibition zone on agar plat es‘ the reduction 0 1' colony forming unit , and the rapid decrease 0 1' viable cell number 0 1' all bacterial species exarnined while those 0 1' control bacteria treated so ley wi th ei t her light 0 1' photosensiti zer were unchanged. The susceptibility of 8. aureush and P. aeru - ginosa was much higher t han that 01' the other strains These resu lts show tha t photodynamic t hera py using photosensi ti zer chlorin e6 is very effective to inhibit bacterial s urviva l, suggesti ng t hat t his system can be clin ically appli cable as an alternative antibacterial strategy to treat mul t iple drug-resistant bacteria
Among patients with di seases of dental 01' oral & maxillol'acial a reas, those who have pathologic lesions ta ke upon a considerable part of these pat ients , The accurate diagnosis is importa nt for the treatment of them Oral and max illofacial lesions may have specifi c characteristics associated with tooth, oral mucosa‘ sali vary gland itself and its devel opmental process, For histopathologic diagnosis of oral and maxill ofacial lesions . pa thologist s hould unde rstand pathogenesis, clinical features, radiographic appearance, treatment, and prognosis of the lesions. [n the hos pital that had oral surgeons on staff, but not an oral pathologist, they sent the pa thologic samples and requ ested the delïn itive diagnosis t。 the oral pathologist worked in th e other dental college hos pita l, Recently, however, it had been impossible for some reasons 80 they sent the samples to general pathologists worked in private clinical laboratory center, 8ince then, oral surgeons and their pati ents were occasionally suffered I'rom unreliabl e and even inacc ura te diagnoses and improper treatments We would like to review the cases that general pa thologists made wrong diagnosis and emphasize the necessity and importance of oral pathologists for oral surgeons.
Glycyrrhiza ura lensis (Leguminosae) has long been known as an ant i-i nflammatory agent for gastric 띠cers , arthri t is, and rheumaLism. 1'he f1avonoid glycyr ol isolated from Glycyrrhiza uralensis dramatically inhibits phorbol ester (PMA)-induced NF-kB-dependent transcriptional activity, as determined by luciferase activity in HEK293T cells To in vestigate the global gene expression profiling by glycyrol, we performed high-density oligonucleotide microarrays, Our microarray analysis showed that gl ycY I 이 inhi bited phorbol ester-induced NF-kB-dependent transcriptional activity in inflarnmatory-related gene expression, RT-PCR analysis based on microarry data showed that NF-kB-dependent genes such as CCL2‘ CCL7. CD44, and HSPB8 in addition to NF-kB itself were significantly down-regulated by glycyrol Treatment with glycyrol inhibited ]-kB degradation induced by PMA, suggesting that glycyrol has a potential anti-in flammatory activity by modulating NF-kB-dependent pathways. Also, the microarray data showed that glycyr이 appears to induce gene expression related to p53-dependent apoptosis t hrough ENDO G instead of CAD/DFF and AlF/PDCD8 as down stream apoptosis factor in HEK293T tumor cell s and to induce an added function as oncogenes in connection with apoptoslS
Nerve gro때h factor-induced B (NGFI-B, Nur77) is an orphan nuclear receptor with no known endogenous Iigands , however‘ recent stuclies on a series of methylene -substituted diindolylmethanes (C-DIMs) have identified 1,l-bis(3’ - In dolyl) -l-(phenyl)methane (DIM-C-Ph) and l , l -bis(3’ indolyl)-l-(p-anisyl)methane (DIM-C-pPhOCHa) as Nur77 agonist Nur77 is expressed in several colon cancer cell lines (RKO, SW480, HCT-116, HT-29 and HCT-15) and we a lso observed by irnmunostaining that Nur77 was overexpressed in colon tumors compared to normal colon tIssue DIM-C-Ph and DlM-C-pPhOCH3 decreased survival and induced apoptosis in RKO colon cancer cells and this was accompanied by in ductdion of tumor nec rosis factor-related apoptosis-incluced ligand (TRAlL) protein, The induct ion of a poptosis and TRAlL by DIM-C-pPhOCH3 was significantly inhibited by a small inhibitory RNA for Nur77 (iNur77); however, it was evide nt from RNA in terference studies that DIM-C-pPhOCH3 a1so induced Nur77-independent apoptosis. Analysis o( DIM-C-pPhOCH3-induced gene expression using microarrays idontifiod sovoral proapoptotic genos and analysis by ro verse t ranscriptase PCR in the presence 0 1' absence of iNru77 showed that incluction of prograrnmed cell death gene 1 (PDcm) was Nur77-dependent‘ whereas induction of cystathionase (CSE) and activating transcription factor 3 (ATF3) was Nur77-independent, DIM-C-pPhOCHa (25 mg/kg/day) also inhi bited tumor growth in athymic nude mice bearing RKO cell xenograft, These results demonstrate that Nur77-active C-DIM compounds represent a new class of anti-colon cancer drugs that act through receptor- dependent and - independent pathway
Photodynamic therapy(PDT) 는 특정 광 감응 물질 에 광 조사를 수행하여 세 포내애서 활성 산소종(ROS) 의 증가를 통한 암세 포의 사띨을 유도하는 방법이다 광 감응 물질은 암세 포에 선택 적으로 흡수되어 특정 파장의 빛을 홉수하여 다량의 ROS를 발생하여 암세 포의 사멸을 유도한다, 그러나 PDT 수행 시 ROS의 세 포내 작용에 따른 사띨 기전 이 영확히 알려지 지 않았고, 비 선 택 성으로 인한 정 상 세포애서의 피해 도 유발될 수 있다고 보고되었다 본 연 구애서 는 굉 감웅제인 He ma to por p h y rin을 이 용하여 구깅암 세포주인 He p2에서 광조사를 통한 세포 사멸 에 관한 연 구를 수행하였다 Confocal mi crosco py를 통한 분석에서 Hemato po r phyrin은 홉수 시 간에 따라 세포막에서 세 포질 핵 으로의 위치함을 관찰 할 수 있었고. 전기 영 동에 따른 DNA 분절 분석에서 24 시간이상 홉수된 상태 에서 ladder 패턴을 보임으로써 세 포 자띨사에 이 르는 만웅을 보였다 DCF - DA에 의힌 세 포내 ROS 분석 을 수행힌 결과 Hema to po rphyrin의 흡수 시간이 증가할수록 세포 내부에서의 ROS 발생이 증가함을 획 인 할 수 있었 다 이와 같은 결과에 따르면 Hematoporphyrin을 이용한 PDT에서 h ematoporphy ri n의 홉수 시 간에 따라 세 포 자띨사가 유도되었고. 특히 Hematoporphyrin은 흡수 시 간이 증가하여 세 포 내 부까지 충분히 Hematoporphyri n 이 작용된 경우에 서 ‘ ROS 발생애 따른 미 토콘드리아 의존적 경 로를 통해 세 포 자멸사가 유도되 었음을 확인 할 수 있었다-