Protease from various sources have been studied biotecnologically. For biotechnological applications, one highly preferred enzyme is protease. There have been no reports of cloned genes encoding digestive proteases in the Laccotrephes japonenis, Ranatra unicolor, Muljarus japonicus. These insects are considered to be a predator of aquatic insects. RT-PCR was used to amplify cDNA fragments for digestive proteases from total RNA the hole body of the insects. The flanking sequences of the 5'- and 3'- end of the these genes were characterized by RACE-PCR. Sequence analysis showed that these genes contained complete ORF. The deduced amino acid sequences of these protease showed 62% identity to the serine protease of Creontiades dilutus, 58% to Lygus loneolaris trypsin-like serine proteinase, 54% to Triatonatoma infestans salivary trypsin. To generate Laccotrephes japonensis serine protease, the DNA fragment coding for serine protease is cloning into suttle vector pBACⅠ, named pBAC1-JG and infected to Spodoptera frugiperda (sf9) insect cell. The cDNA encoding JG was expressed as a 32-kDa polypeptide in baculovirus infected insect cells and the recombinant protein showed activity in the protease enzyme assay using gelatin as a substrate.

A glucose-regulated protein 78 (grp78) gene, which is belongs to a heat shock cognate 70 (hsc70) subfamily, was cloned from Indian meal moth, Plodia interpunctella. Its full length cDNA was 2679 bp and contains a 1980 bp open reading frame. The translated amino acid sequence consists of 660 residues with a calculated molecular mass of 72,975 Da and an isoelectronic point (pI) of 5.27. It contains several highly conserved functional motifs of the Hsp70 family and, particularly, C-terminal motif of KDEL that is characteristic for endoplasmic reticulum (ER) hsc70. Its deduced amino acid sequence shows a high identity (83-94%) with Hsc70s of other insects and grouped with Hsc70-3 among 5 Hsc70 members of Drosophila melanogaster. During development the grp78 transcript level was high in egg, feeding larval and adult stages but low in molting and wandering larval and pupal stages. Particularly its level was higher in the gut than integument and fat body of fifth instars. Furthermore its level was greatly decreased when fifth instar larvae were starved for 48 hrs but recovered at 3-6 hrs after re-fed diet. Our data suggests that grp78 is a member of hsc70 gene that belongs to ER and may have a role for energy metabolism at cellular level.

Three venom peptides, OdVP1, OdVP2, and OdVP3 were isolated from the venom of the solitary wasp Orancistrocerus drewseni (Hymenoptera: Eumenidae). The venom peptide amino acid sequences were determined by Q-TOF/MS/MS. The OdVP1, 2, and 3 with amidated C-terminals showed similar peptide sequences to the mastoparan from Vespula lewisii or the protonectin from Protonectarina sylveirae, suggesting that they adopt an amphipathic α-helix secondary structure. The amidation of C-terminal Leu of the venom peptides have been known to be required for their biological activities. The full-length open reading frame (ORF) sequences of the OdVP1, 2, and 3 were analyzed by 5’- and 3’-rapid amplification of cDNA ends (RACE). The overall gene structure of OdVPs showed a high homology to that of mastoparan B from Vespa basalis by containing signal sequence, prosequence, mature peptide and C-terminal glycine, but the mature peptide sequences were distinct from each other. The toxicological property and antimicrobial activity of OdVPs were characterized using synthetic peptides. This study on the venom peptides from O. drewseni should promote further studies on bioactive ingredients in the venom of solitary hunting wasps.

Attacin is an antibacterial protein that is secreted by fat body cells of insect larva in response to bacterial infection. A 949 bp cDNA encoding the antibacterial protein attacin was isolated by employing annealing control primer (ACP)-based GeneFishing polymerase chain reaction (PCR) from immunized Papilio xuthus larvae. The attacin cDNAs encoded 250 amino acid residues open reading frame with 60 residues prepropeptide. The deduced amino acid sequence of P. xuthus attacin showed significant identities with other Lepidopteran attacins. The attacin transcript was detected at significant level after injection with bacterial lipopolysaccharide (LPS). The predicted mature attacin was expressed as soluble fusion protein efficiently in bacterial expression system. To increase productivity and solubility, attacin was translationally fused with thioredoxin (Trx) protein and expressed in E. coli cells that are highly sensitive to the mature attacin. The recombinant attacin exhibited antibacterial activity against Gram-negative bacteria.

The morecular cloning, gene structure, expression and enzyme activity of a serine-like proteas frome Laccotrephes Japonensis were examined. In this study, RT-PCR was used to amplify cDNA fragments for serine-like proteases from total RNA the hole body of Laccotrephes japonensis. The flanking sequences of the 5'- and 3'- end of the this gene were characterized by RACE-PCR. Sequence analysis showed that this gene contained an 963bp ORF encoding 321 amino acids. The deduced amino acid sequence of this protease showed 62% identity to the serine protease of Creontiades dilutus, 58% to Lygus loneolaris trypsin precuror LlsgP4, 54% to Triatonatoma infestans salivary trypsin. To generate Laccotrephes japonensis serine-like protease, the DNA fragment coding for serine protease is cloning into suttle vector pBACⅠ, named pBAC1-JG and infected to Spodoptera frugiperda (sf9) insect cell. The cDNA encoding JG was expressed as a 32-kDa polypeptide in baculovirus infected insect cells and the recombinant JG showed activity in the protease enzyme assay using gelatin as a substrate.

To determine the characteristics of the Korean porcine reproductive and respiratory syndrome virus (PRRSV), CA, which was isolated from the serum of an infected pig in 2006, we investigated the nucleotide sequence and expression of the structural ORFs (ORFs 2 to 7) using the bApGOZA system. We found that the structural ORFs 2 to 7 of CA consisted of 3188 nucleotides that were the same as those formed from VR-2332. Comparison of the CA with the other strains revealed nucleotide sequence identity ranging from 89.8 to 99.5%. To better understand the genetic relationships between other strains, phylogenetic analyses were performed. The CA strain was closely related to the other North American genotype strains but formed a distinct branch with high bootstrap support. Additionally, expression levels of the PRRSV proteins in Sf21 cells were strong or partially weak. The results of this study have implications for both the taxonomy of PRRSV and vaccine development.

Innate immunity responses are triggered by the immune challenge and therefore involve signaling processes. The cellular response is initiated by hemocytes and mainly involves phagocytosis and encapsulation of intruders by these cells. To address whether Hc-STAT is activated upon bacterial challenge, we examined the subcellular location of STAT protein in hemocyte by immunostaining. A new insect member of the STAT family of transcription factors (Hc-STAT) has been cloned from the lepidopteran, Hyphantria cunea. The domain involved in DNA interaction and the SH2 domain are well conserved. The gene is transcribed at a low level during all stages of development, and the protein is present in hemocytes, fat body, midgut, epidermis, and Malphigian tuble (Mt). Especially, hemocytes and Mt showed transcriptional activation of Hc-STAT upon Gram (-) bacteria and fungal challenge. Gram (-) bacteria and fungal challenge specifically results in nuclear translocation of Hc-STAT protein and induction of DNA-binding activity that recognizes a STAT target site in H. cunea hemocyte. In vitro treatment with pervanadate translocates Hc-STAT to the nucleus in hemocyte cells. Here we report the first evidence for the involvement hemocyte JAK/STAT pathway upon microbial infection in lepidopteran insect.

Since the birth of Dolly using fully differentiated somatic cells as a nuclear donor, viable clones were generated successfully in many mammalian species. These achievements in animal cloning demonstrate developmental potential of terminally differentiated somatic cells. At the same time, the somatic cell nuclear transfer (SCNT) technique provides the opportunities to study basic and applied biosciences. However, the efficiency generating viable offsprings by SCNT remains extremely low. There are several explanations why cloned embryos cannot fully develop into viable animals and what factors affect developmental potency of reconstructed embryos by the SCNT technique. The most critical and persuasive explanation for inefficiency in SCNT cloning is incomplete genomic reprogramming, such as DNA methylation and histone modification. Numerous studies on genomic reprogramming demonstrated that incorrect DNA methylation and aberrant epigenetic reprogramming are considerably correlated with abnormal development of SCNT cloned embryos even though its mechanism is not fully understood. The SCNT technique is useful in cloning farm animals because pluripotent stem cells are not established in farm animal species. Therapeutic cloning combined with genetic manipulation will help to control various human diseases. Also, the SCNT technique provides a chance to overcome excessive demand for the organs by production of transgenic animals as xenotransplantation resources. Here, we describe the factors affecting the efficiency of generating cloned farm animals by the SCNT technique and discuss future directions of animal cloning by SCNT to improve the cloning efficiency.

Insect nicotinic acetylcholine receptors (nAChRs) are targets for insecticides. Despite the importance of the nAChR as a major target for insecticide action, modulators of nAChRs in insects remain unidentified. Here we describe the cloning and identification of a nAChR modulator gene in an insect. This gene was isolated by searching the firefly Pyrocoelia rufa cDNA library, and the geneitself encodes a protein 120 amino acids in length, named Pr-lynx1. Pr-lynx1 shares all the features, including a cysteine-rich consensus motif and common gene structure, of the Ly-6/neurotoxin superfamily. The recombinant Pr-lynx1, which is expressed as a 12-kDa polypeptide in baculovirus-infected insect Sf9 cells, is normally present at the cell surface asa GPI-anchored protein. Northern and Western blot analyses revealed that Pr-lynx1 is expressed in various tissues, such as the ganglion, brain, mandibular muscle, proventriculus, leg muscle, and epidermis. This expression pattern is similar to the distribution of nAChRs as assayed by α3 nAChR immunoreactivity. Co-expression of Pr-lynx1 in Xenopus oocytes expressing α3β4 nAChRs results in an increase in acetylcholine-evoked macroscopic currents, indicating a functional role of Pr-lynx1 as a protein modulator for nAChRs. This study on Pr-lynx1 is the first report of a modulator of nAChRs in an insect species.

We have previously shown that the larvae of swallowtail butterfly, Papilio xuthus, exhibit substantial antibacterial activity in the hemolymph, upon challenging with bacterial lipopolysaccharide (LPS). Here we report the isolation and molecular characterization of several immune inducible genes that are specifically expressed by employing annealing control primer (ACP)-based GeneFishing polymerase chain reaction (PCR) from P. xuthus the larva. Using 120 arbitrary ACPs, we identified 24 differentially expressed genes (DEGs) that are up-regulated in response to injected LPS. Sequence analysis showed that 18 DEGs revelaed a high sequence similarity to the previously characterized genes of other insects, although 6 DEGs showed no significant similarity to any known genes. Among these inducible transcripts we found 8 putative immune-related genes including cecropin and attacin. Finally, we analysed the expression profiles of potential immune-related genes by RT-PCR and found all of them were considerably increased in the mRNA levels by LPS injection.

Protease from various sources have been studied biotecnologically. For biotechnological applications, one highly preferred enzyme is protease. There have been no reports of cloned genes encoding digestive proteases in the Laccotrephes japonenis, Ranatra unicolor, Muljarus japonicus. These insects are considered to be a predator of aquatic insects. RT-PCR was used to amplify cDNA fragments for digestive proteases from total RNA the hole body of the insects. The flanking sequences of the 5'- and 3'- end of the these genes were characterized by RACE-PCR. Sequence analysis showed that these genes contained complete ORF. The deduced amino acid sequences of these protease showed 62% identity to the serine protease of Creontiades dilutus, 58% to Lygus loneolaris trypsin-like serine proteinase , 54% to Triatonatoma infestans salivary trypsin. In the further study, to generate digestive protease, the DNA fragment coding for serine protease, trypsin-like serine protease were cloning into suttle vector pBACⅠ, and infected to Spodoptera frugiperda (sf9) insect cell. After that, we expect to carry out the proteolytic activity of these recombinant proteases. This is intended as a basis for future studies on the digestive protease in the insects.

Phospholipase A2 (PLA2) is the committed catalytic step of eicosanoid biosynthesis, which has been a common molecular target of several entomopathogens to induce insect immunosuppression. Despite critical importance of PLA2 in insect immunity, its gene structure was not known. This study identified insect PLA2 gene associated with immune reactions in the red flour beetle, Tribolium castaneum. Based on a previous study that an immune-associated PLA2 in insect is secretory type of PLA2 (sPLA2), five highly matched cDNA sequences were obtained from T. castaneum genome database using an sPLA2 sequence probe encoded in Drosophila melanogaster. The expressions of these five putative PLA2 were confirmed by reverse transcriptase-polymerase chain reaction. Out of five genes, one PLA2 gene called TcPLA2B was chosen because it showed specific expression in hemocyte and fat body. TcPLA2B was cloned and expressed in Escherichia coli and its protein was purified. The purified TcPLA2B showed PLA2enzyme activity, which was specifically inhibited by bromophenacyl bromide (a specific sPLA2inhibitor) and dithiothreitol (reducing agent of disulfide bond). It was sensitive to pH (optimum at pH 6.0) and reaction temperature (optimum at 10-30°C), and calcium dependency. An immunofluorescence assay indicated that TcPLA2B was localized near to cellular membrane of the cytosol in the hemocytes of T. castaneum at immune chanlenge. Double-stranded RNA (dsRNA) of TcPLA2B-treated larvae showed knockdown of its mRNA expression and did not form hemocyte nodule formation, while control larvae could exhibit time- and bacterial dose-dependent nodule formation in response to bacterial challenge. Addition of arachidonic acid (the catalytic product of PLA2) to the dsRNA-treated larvae rescued the inhibition of nodule formation. These results suggest that TcPLA2B gene is associated with insect immune reaction.

Members of the Vps (Vacuolar protein sorting) protein family involved in the formation of the retromer complex have been discovered in a variety of species such as yeast, mouse, and human. A mammalian retromer complex is composed of Vps26, Vps29, and Vps35 proteins and plays and important role in cation-independent mannose-6-phosphate receptor retrieval from the endosome to the trans-Golgi network. In this study, we have identified the full-length sequences of the retromer components of Vps26, Vps29, and Vps35 in micro pigs. The cDNA sequences of these retromer components have been determined and the result showed there is 99% homology among the component counterparts from mouse, micro pigs, and humans. In addition, the retromer complexes formed with hetero-components were found in the brain of micro pigs. Based on above results, we suggest mammalian Vps components are well conserved in micro pigs.

Al thou gh it was reported that the human genome had been entirely seq uenced. so far there frequently appeared non - redundant cDNAs in gene cloning of cellular mRNAs. Consequently a lot of effort is required to ide ntified the new genes for theil‘ localization in chromosome and their functlons If the new genes had small size sequences 0 1' were expressed in low level , 5' RACE became ha rd unexpectedly. Here. we demonstrated a new method of 5’ RACE by PCR cloning using hair pin prime r and cDNA template produced by gene specific primer. Firstly .. total RNA obtained from tissue 0 1' cells is primed for rever se transcri ption (Superscript lI) by antisense primer (AS-l) specilïc to the objective gen e in order to produce single strand cDNAs The cDNAs usua lly have 3' overhanging of CCC seq uence. SeconcUy, a hail‘ pin primer overhang GGG seq uence in 3' end (i .e ‘ Tn'AGTGAGGGTTA AGAAGGAGAATTAACCCTCACTAAAGGG) is rnixed with the cDNA produced above, and 1'01- lowed by heating at 70'C for 5 min and cooled in room temperature to make hairpin-end template cDNAs Thirdly, For PCR is performed using the ha irpin-end template cDNAs and primer set of inner hairpin sense primer (i . e., TAACCCTCACTA AAGGGG) and AS-1 using pfu polymerase. And next. the PCR product can be directly sequenced 0 1' subcloned into vector to seq uence the purified plasrnid DNA. In our laboratory several unidentified new genes have been under investigation for theil‘ genomic l oci and functions. However. one of them. a human short helical protein 1 (hSHP-1) was a short gene less than 600 bp in s ize. encoding 45 amino acids . hSHP-1 is able to produce a potent antimicrobial peptide which has similar strength to magainin from frogs. The hSHP-1 also showed multifunctional roles of innate imrnunity including not only the ant imicrobial activity against methi cillin resistant strains but a lso anti- neoplastic effect on precance rous cell s . Fluorescence in situ hybricli zation in chromosome was not successful due to weak signal. and genornic Southern of hSHP-l showecl a higher weak bancl. which is not clearly definecl as an comrnon genomic locus‘ but could be cons idered its or igin from centromere region which contains less frequent restri ction sites. And more, th e ordinary PCR cloning performed pre vious ly from human genornic DNA produced only repetitive non-specific DNAs which were not matched to hSHP-l cDNA This study demonstrated how we have don e the PCR cl oning usi ng ha irpin primer and cDNA template reve rsely transcribed by gene specific primer.