Since the birth of Dolly using fully differentiated somatic cells as a nuclear donor, viable clones were generated successfully in many mammalian species. These achievements in animal cloning demonstrate developmental potential of terminally differentiated somatic cells. At the same time, the somatic cell nuclear transfer (SCNT) technique provides the opportunities to study basic and applied biosciences. However, the efficiency generating viable offsprings by SCNT remains extremely low. There are several explanations why cloned embryos cannot fully develop into viable animals and what factors affect developmental potency of reconstructed embryos by the SCNT technique. The most critical and persuasive explanation for inefficiency in SCNT cloning is incomplete genomic reprogramming, such as DNA methylation and histone modification. Numerous studies on genomic reprogramming demonstrated that incorrect DNA methylation and aberrant epigenetic reprogramming are considerably correlated with abnormal development of SCNT cloned embryos even though its mechanism is not fully understood. The SCNT technique is useful in cloning farm animals because pluripotent stem cells are not established in farm animal species. Therapeutic cloning combined with genetic manipulation will help to control various human diseases. Also, the SCNT technique provides a chance to overcome excessive demand for the organs by production of transgenic animals as xenotransplantation resources. Here, we describe the factors affecting the efficiency of generating cloned farm animals by the SCNT technique and discuss future directions of animal cloning by SCNT to improve the cloning efficiency.

Insect nicotinic acetylcholine receptors (nAChRs) are targets for insecticides. Despite the importance of the nAChR as a major target for insecticide action, modulators of nAChRs in insects remain unidentified. Here we describe the cloning and identification of a nAChR modulator gene in an insect. This gene was isolated by searching the firefly Pyrocoelia rufa cDNA library, and the geneitself encodes a protein 120 amino acids in length, named Pr-lynx1. Pr-lynx1 shares all the features, including a cysteine-rich consensus motif and common gene structure, of the Ly-6/neurotoxin superfamily. The recombinant Pr-lynx1, which is expressed as a 12-kDa polypeptide in baculovirus-infected insect Sf9 cells, is normally present at the cell surface asa GPI-anchored protein. Northern and Western blot analyses revealed that Pr-lynx1 is expressed in various tissues, such as the ganglion, brain, mandibular muscle, proventriculus, leg muscle, and epidermis. This expression pattern is similar to the distribution of nAChRs as assayed by α3 nAChR immunoreactivity. Co-expression of Pr-lynx1 in Xenopus oocytes expressing α3β4 nAChRs results in an increase in acetylcholine-evoked macroscopic currents, indicating a functional role of Pr-lynx1 as a protein modulator for nAChRs. This study on Pr-lynx1 is the first report of a modulator of nAChRs in an insect species.

We have previously shown that the larvae of swallowtail butterfly, Papilio xuthus, exhibit substantial antibacterial activity in the hemolymph, upon challenging with bacterial lipopolysaccharide (LPS). Here we report the isolation and molecular characterization of several immune inducible genes that are specifically expressed by employing annealing control primer (ACP)-based GeneFishing polymerase chain reaction (PCR) from P. xuthus the larva. Using 120 arbitrary ACPs, we identified 24 differentially expressed genes (DEGs) that are up-regulated in response to injected LPS. Sequence analysis showed that 18 DEGs revelaed a high sequence similarity to the previously characterized genes of other insects, although 6 DEGs showed no significant similarity to any known genes. Among these inducible transcripts we found 8 putative immune-related genes including cecropin and attacin. Finally, we analysed the expression profiles of potential immune-related genes by RT-PCR and found all of them were considerably increased in the mRNA levels by LPS injection.

Protease from various sources have been studied biotecnologically. For biotechnological applications, one highly preferred enzyme is protease. There have been no reports of cloned genes encoding digestive proteases in the Laccotrephes japonenis, Ranatra unicolor, Muljarus japonicus. These insects are considered to be a predator of aquatic insects. RT-PCR was used to amplify cDNA fragments for digestive proteases from total RNA the hole body of the insects. The flanking sequences of the 5'- and 3'- end of the these genes were characterized by RACE-PCR. Sequence analysis showed that these genes contained complete ORF. The deduced amino acid sequences of these protease showed 62% identity to the serine protease of Creontiades dilutus, 58% to Lygus loneolaris trypsin-like serine proteinase , 54% to Triatonatoma infestans salivary trypsin. In the further study, to generate digestive protease, the DNA fragment coding for serine protease, trypsin-like serine protease were cloning into suttle vector pBACⅠ, and infected to Spodoptera frugiperda (sf9) insect cell. After that, we expect to carry out the proteolytic activity of these recombinant proteases. This is intended as a basis for future studies on the digestive protease in the insects.

Phospholipase A2 (PLA2) is the committed catalytic step of eicosanoid biosynthesis, which has been a common molecular target of several entomopathogens to induce insect immunosuppression. Despite critical importance of PLA2 in insect immunity, its gene structure was not known. This study identified insect PLA2 gene associated with immune reactions in the red flour beetle, Tribolium castaneum. Based on a previous study that an immune-associated PLA2 in insect is secretory type of PLA2 (sPLA2), five highly matched cDNA sequences were obtained from T. castaneum genome database using an sPLA2 sequence probe encoded in Drosophila melanogaster. The expressions of these five putative PLA2 were confirmed by reverse transcriptase-polymerase chain reaction. Out of five genes, one PLA2 gene called TcPLA2B was chosen because it showed specific expression in hemocyte and fat body. TcPLA2B was cloned and expressed in Escherichia coli and its protein was purified. The purified TcPLA2B showed PLA2enzyme activity, which was specifically inhibited by bromophenacyl bromide (a specific sPLA2inhibitor) and dithiothreitol (reducing agent of disulfide bond). It was sensitive to pH (optimum at pH 6.0) and reaction temperature (optimum at 10-30°C), and calcium dependency. An immunofluorescence assay indicated that TcPLA2B was localized near to cellular membrane of the cytosol in the hemocytes of T. castaneum at immune chanlenge. Double-stranded RNA (dsRNA) of TcPLA2B-treated larvae showed knockdown of its mRNA expression and did not form hemocyte nodule formation, while control larvae could exhibit time- and bacterial dose-dependent nodule formation in response to bacterial challenge. Addition of arachidonic acid (the catalytic product of PLA2) to the dsRNA-treated larvae rescued the inhibition of nodule formation. These results suggest that TcPLA2B gene is associated with insect immune reaction.

Members of the Vps (Vacuolar protein sorting) protein family involved in the formation of the retromer complex have been discovered in a variety of species such as yeast, mouse, and human. A mammalian retromer complex is composed of Vps26, Vps29, and Vps35 proteins and plays and important role in cation-independent mannose-6-phosphate receptor retrieval from the endosome to the trans-Golgi network. In this study, we have identified the full-length sequences of the retromer components of Vps26, Vps29, and Vps35 in micro pigs. The cDNA sequences of these retromer components have been determined and the result showed there is 99% homology among the component counterparts from mouse, micro pigs, and humans. In addition, the retromer complexes formed with hetero-components were found in the brain of micro pigs. Based on above results, we suggest mammalian Vps components are well conserved in micro pigs.

Al thou gh it was reported that the human genome had been entirely seq uenced. so far there frequently appeared non - redundant cDNAs in gene cloning of cellular mRNAs. Consequently a lot of effort is required to ide ntified the new genes for theil‘ localization in chromosome and their functlons If the new genes had small size sequences 0 1' were expressed in low level , 5' RACE became ha rd unexpectedly. Here. we demonstrated a new method of 5’ RACE by PCR cloning using hair pin prime r and cDNA template produced by gene specific primer. Firstly .. total RNA obtained from tissue 0 1' cells is primed for rever se transcri ption (Superscript lI) by antisense primer (AS-l) specilïc to the objective gen e in order to produce single strand cDNAs The cDNAs usua lly have 3' overhanging of CCC seq uence. SeconcUy, a hail‘ pin primer overhang GGG seq uence in 3' end (i .e ‘ Tn'AGTGAGGGTTA AGAAGGAGAATTAACCCTCACTAAAGGG) is rnixed with the cDNA produced above, and 1'01- lowed by heating at 70'C for 5 min and cooled in room temperature to make hairpin-end template cDNAs Thirdly, For PCR is performed using the ha irpin-end template cDNAs and primer set of inner hairpin sense primer (i . e., TAACCCTCACTA AAGGGG) and AS-1 using pfu polymerase. And next. the PCR product can be directly sequenced 0 1' subcloned into vector to seq uence the purified plasrnid DNA. In our laboratory several unidentified new genes have been under investigation for theil‘ genomic l oci and functions. However. one of them. a human short helical protein 1 (hSHP-1) was a short gene less than 600 bp in s ize. encoding 45 amino acids . hSHP-1 is able to produce a potent antimicrobial peptide which has similar strength to magainin from frogs. The hSHP-1 also showed multifunctional roles of innate imrnunity including not only the ant imicrobial activity against methi cillin resistant strains but a lso anti- neoplastic effect on precance rous cell s . Fluorescence in situ hybricli zation in chromosome was not successful due to weak signal. and genornic Southern of hSHP-l showecl a higher weak bancl. which is not clearly definecl as an comrnon genomic locus‘ but could be cons idered its or igin from centromere region which contains less frequent restri ction sites. And more, th e ordinary PCR cloning performed pre vious ly from human genornic DNA produced only repetitive non-specific DNAs which were not matched to hSHP-l cDNA This study demonstrated how we have don e the PCR cl oning usi ng ha irpin primer and cDNA template reve rsely transcribed by gene specific primer.

본 연구는 재래 산양의 체세포 핵이식에 의하여 생산한 복제 산양(진순이)의 조직으로부터 공여 핵을 배양하여 다시 핵이식을 실시하여 재복제에 따른 융합율과 분할율, 이식 후의 수태율 등을 조사하여 재복제 가능성 여부를 검토하기 위하여 실시하였다. 공여 세포는 귀 유래 섬유아세포를 분리 배양하여 사용하였으며, 체내 성숙 난자는 성숙한 미경산 재래 산양에 과배란을 유기하여 외과적인 방법으로 난관 관류를 통해 회수하여 핵이식을 실시하였다. 핵이식란의 융합은 전