논문 상세보기
5' RACE by PCR Cloning Using Hairpin Primer and cDNA Template Produced by Gene Specific Primer KCI 등재
- 언어ENG
- URLhttps://db.koreascholar.com/Article/Detail/324580
p.295
Al thou gh it was reported that the human genome had been entirely seq uenced. so far there frequently appeared non - redundant cDNAs in gene cloning of cellular mRNAs. Consequently a lot of effort is required to ide ntified the new genes for theil‘ localization in chromosome and their functlons If the new genes had small size sequences 0 1' were expressed in low level , 5' RACE became ha rd unexpectedly. Here. we demonstrated a new method of 5’ RACE by PCR cloning using hair pin prime r and cDNA template produced by gene specific primer. Firstly .. total RNA obtained from tissue 0 1' cells is primed for rever se transcri ption (Superscript lI) by antisense primer (AS-l) specilïc to the objective gen e in order to produce single strand cDNAs The cDNAs usua lly have 3' overhanging of CCC seq uence. SeconcUy, a hail‘ pin primer overhang GGG seq uence in 3' end (i .e ‘ Tn'AGTGAGGGTTA AGAAGGAGAATTAACCCTCACTAAAGGG) is rnixed with the cDNA produced above, and 1'01- lowed by heating at 70'C for 5 min and cooled in room temperature to make hairpin-end template cDNAs Thirdly, For PCR is performed using the ha irpin-end template cDNAs and primer set of inner hairpin sense primer (i . e., TAACCCTCACTA AAGGGG) and AS-1 using pfu polymerase. And next. the PCR product can be directly sequenced 0 1' subcloned into vector to seq uence the purified plasrnid DNA. In our laboratory several unidentified new genes have been under investigation for theil‘ genomic l oci and functions. However. one of them. a human short helical protein 1 (hSHP-1) was a short gene less than 600 bp in s ize. encoding 45 amino acids . hSHP-1 is able to produce a potent antimicrobial peptide which has similar strength to magainin from frogs. The hSHP-1 also showed multifunctional roles of innate imrnunity including not only the ant imicrobial activity against methi cillin resistant strains but a lso anti- neoplastic effect on precance rous cell s . Fluorescence in situ hybricli zation in chromosome was not successful due to weak signal. and genornic Southern of hSHP-l showecl a higher weak bancl. which is not clearly definecl as an comrnon genomic locus‘ but could be cons idered its or igin from centromere region which contains less frequent restri ction sites. And more, th e ordinary PCR cloning performed pre vious ly from human genornic DNA produced only repetitive non-specific DNAs which were not matched to hSHP-l cDNA This study demonstrated how we have don e the PCR cl oning usi ng ha irpin primer and cDNA template reve rsely transcribed by gene specific primer.
