In order to develop a protective carrier scaffolder for the external usage of medical and hygienic materials, three essential protective elements existing in nature, i.e., algin, cellulose, and calcium phosphate apatite, were investigated. The algin is a main skeletal component of sea weeds, the cellulose is of vegetables, and the calcium phosphate apatite is of vertebral animals. In the present study we select the agarose which is a derivative from algin, the cellulose fiber obtained from skin of sea squirt, calcium oxide purified from shell powder, and tricalcium phosphate apatite purchased commercially. Consequently, the agarose-cellulose hybrid was made by the hydrogen bonds intermediating the calcium phosphate apatite between agarose and cellulose molecules. As the calcium phosphate apatite is formed by the addition of calcium hydroxide into tricalcium phosphate solution, we used calcium oxide to accelerate the hybridization between the agarose and calcium phosphate apatite and also between the cellulose and calcium phosphate apatite. In the phase contrast microscopic observation the agarose-cellulose hybrid showed more compact matrix structure than the mixture of agarose and cellulose. The agarose-cellulose hybrid showed increased storage modulus but decreased loss modulus in Rheometer test compared to those of the other materials tested in this study, representing that the agarose-cellulose hybrid has the highest elasticity among them and similar water capacity to agarose. The agarose-cellulose hybrid showed the strongest antimicrobial effect in bacteria killing assay than the other materials, and also it showed a potent blood clotting effect but no immunological hypersensitivity on the human skin. From the above results we presumed that the nobel material, agarose-cellulose hybrid, is a compact scaffolding matrix which has proper elasticity, high capacity to hold substrates, and antimicrobial and blood clotting property potent enough to carry the bio-medical and hygienic materials for external treatment safely.

Al thou gh it was reported that the human genome had been entirely seq uenced. so far there frequently appeared non - redundant cDNAs in gene cloning of cellular mRNAs. Consequently a lot of effort is required to ide ntified the new genes for theil‘ localization in chromosome and their functlons If the new genes had small size sequences 0 1' were expressed in low level , 5' RACE became ha rd unexpectedly. Here. we demonstrated a new method of 5’ RACE by PCR cloning using hair pin prime r and cDNA template produced by gene specific primer. Firstly .. total RNA obtained from tissue 0 1' cells is primed for rever se transcri ption (Superscript lI) by antisense primer (AS-l) specilïc to the objective gen e in order to produce single strand cDNAs The cDNAs usua lly have 3' overhanging of CCC seq uence. SeconcUy, a hail‘ pin primer overhang GGG seq uence in 3' end (i .e ‘ Tn'AGTGAGGGTTA AGAAGGAGAATTAACCCTCACTAAAGGG) is rnixed with the cDNA produced above, and 1'01- lowed by heating at 70'C for 5 min and cooled in room temperature to make hairpin-end template cDNAs Thirdly, For PCR is performed using the ha irpin-end template cDNAs and primer set of inner hairpin sense primer (i . e., TAACCCTCACTA AAGGGG) and AS-1 using pfu polymerase. And next. the PCR product can be directly sequenced 0 1' subcloned into vector to seq uence the purified plasrnid DNA. In our laboratory several unidentified new genes have been under investigation for theil‘ genomic l oci and functions. However. one of them. a human short helical protein 1 (hSHP-1) was a short gene less than 600 bp in s ize. encoding 45 amino acids . hSHP-1 is able to produce a potent antimicrobial peptide which has similar strength to magainin from frogs. The hSHP-1 also showed multifunctional roles of innate imrnunity including not only the ant imicrobial activity against methi cillin resistant strains but a lso anti- neoplastic effect on precance rous cell s . Fluorescence in situ hybricli zation in chromosome was not successful due to weak signal. and genornic Southern of hSHP-l showecl a higher weak bancl. which is not clearly definecl as an comrnon genomic locus‘ but could be cons idered its or igin from centromere region which contains less frequent restri ction sites. And more, th e ordinary PCR cloning performed pre vious ly from human genornic DNA produced only repetitive non-specific DNAs which were not matched to hSHP-l cDNA This study demonstrated how we have don e the PCR cl oning usi ng ha irpin primer and cDNA template reve rsely transcribed by gene specific primer.

[n order to obtain the trlle expected DNA prod uct from PCR and RT-PCR using genornic DNA or cDNA reversely transcribed from mRNA. the PCR should be done in an appropriated condition. Sometimes the PCR was repeatedly fail ed. and cventllally the PCR product was turned out to be nonspecific and rudimentary . And more‘ t he PCR prodllctwas not reproducible even though careflll repeat of experiments. As the PCR was based on the exact primel hybridization. the condition of primer hybridization should be properly controlled by a nnealing temperatllre. But the selection of primer seqllences for targeting a specific gene is mostly important. A new method of primer eval uation is now available llsing DNA base pair polarity program. This study presents an example of PCR targeting to human Bax gene using genomic DNA. The DNA base pair polarity theory can di vide the genetic cord into propel DNA segments and calclllaLe their DNA base pair hybridization energy. Thus. mathematically the degree 0(' exact primer hybridization can be expected for the t r1l8 targeting of PCR. However, the DNA base pair polal'ityanalysis demonstrates that the more frequent number of DNA segment incl'eased the specificity of PCR. but decreased its sensitivity . While the greater polarity of DNA segment composed of increased nllmber of polarized DNA base pairs showed increased sensitivi ty 0 1' PCR. bllt relati vely decreased specificity of PCR. With the mllltiple analysis of PCR. especially for PCR cloning from the gDNA and cDNA, we found that the primers themselves showed secondary strllcture of partial hybridization between sameprimers or each pair primers. The DNA base pail‘ polarity signal can directly demonstrated symmetric sequences 0 1' each primer. and also can distinguish the dimmer formation from each pair primers. At least the symmetric seqllence of fOlll‘ base pairs dramatically showed the dimrner formation. On the other hand. in addi tion Lo the statlls of DNA base pair polarity the three-dimensional strllctllre of DNA dOllble helix targeted by the primer seqllences may affect the sensitivity and specificity of PCR detection. The present study introduced a new method of primer evalllation and selection in order to obtain abundant and exacL! y-trlle DNA product for genomic ffilltation analysis and gene expression profï le

In order to perform the protein analysis using the paraffin sections previous fixed with formalin, we applied the ImmunoMemBlot (IMB) method1) to detect the epitopes of target proteins with specific antibodies. In this study the protein extracts were obtained from the paraffin sections of each representative case of ameloblastoma, adenomatoid odontogenic tumor (AOT), and normal gingiva, and more a protein extract from fresh tissue of ameloblastoma was also compared to evaluate the IMB results used with 24 different antibodies. First of all, in the comparison between the paraffin section extract and fresh tissue extract of ameloblastoma, the latter consistently showed more positive IMB reaction than the former. Meanwhile, the paraffin section extract of ameloblastoma was more comparable with that of normal gingival, disclosing that most of proliferating genes, oncogenes, and apoptosis related genes, i.e., PCNA, CDK4, c-erbB2, CEA, p53, Bax, Bad, FLIP, FAS, Bcl-2, p21, N-ras, MMP-2, MMP-9, caspase-3, -8, -9, were highly expressed in ameloblastoma, but EGFR, HGF, and VEGF were similarly expressed both in the ameloblastoma and in normal human gingiva. On the other hand, the comparison between ameloblastoma and AOT both in the immunohistochemistry and IMB using their paraffin section extracts clearly demonstrated that the ameloblastoma showed more expression of proliferating genes and oncogenes while the AOT showed more expression of apoptosis related genes, i.e., Bax, Bad, FLIP, and caspase-9. Taken together, these data suggest that the IMB can be used for the primary screening of quantitative protein analysis using the paraffin section extract, and that the IMB results could be evaluated in conjunction with the immunohistochemical observation.

Immuno-MemBlot is a technique for detecting, analyzing, and identifying proteins, similar to the Western blot technique but differing in that protein samples are not separated electrophoretically but are spotted through circular or slot templates directly onto the membrane. Recently we developed a new Immuno-MemBlot (IMB) method applying immunoreactions and coloring procedures directly in the wells of MemBlot apparatus, which were connected by canals to perform drainage for reagent application and buffer irrigation. This IMB method was designed to get theimmunoblot results more rapidly and clearly than the previous immunoblot ones. This study is aimed to evaluate the analytical accuracy of IMB using different biological assay. In the sensitivity test of IMB the monoclonal antibody can clearly detect the 30 ng (about 12 pM) of Mucocidin peptide (35 mer), and is also available to detect at least 10 ng (about 4 pM) of Mucocidin peptide (35 mer). The IMB was effective in the quantitative analysis of methothrexate (MTX) assay for cellular apoptosis. And more, this IMB is useful to screen large number of specific samples with ease and accuracy in a short time. In the screenings for the presence of Mucocidin in saliva the quantitative comparison is conspicuous among 48 persons depend on the different conditions ofgender, drinking and smoking habits, and oral diseases. Therefore, it is presumed that, even though the target proteins were partly degraded, a specific epitope can be detected if a monoclonal antibody was still reactive. Conclusively, these data suggest that the IMB can be useful in the primary qualitativeand quantitative analysis of proteins in various fluids, i.e., blood, saliva, tear, urine, etc.

Gene reg비 at i o n during the human craniofacial development is not well understood In effort to understand n ewly identifï ed genes that may play role(s) in the human craniofacial development, non-redundan t genes were isolated from the s ubtracted cDNA libra ry of human embryonal craniofacial tissues and examined their possible structu ral rolc in parallcl with thosc gcncs from isolatecl human c h o nclroc)πes cDNA library. Fifty genes were init ia ll y chosen from 398 clones iso latecl were used for selective dominant expression in both chondrocytes and the craniofacial sections of 10 weeks old human embryo by in situ hybridization method. Based upon the high levels 。f expression, we have identifi ecl seven unknown genes; ch89, ch96. ch129. ch 153. ch 276 ch285. and ch334 . In 。rder to unde rs tancl the possi ble role of these genes‘ the structural simulation of the expressed proteins were constructecl by Sybyl 6.6 program. Ch 276 gene was same with a clone, c14 0 1' f173. registered in GenBank(NM_022489) a nd is composed 0 1' 323 amino acids having a reverse s ignaling domain from the extra- cellular matrix(C-terminal) to cell membrane(N-terminal) and 12 turns of helical structure. Gene protein also r etains a famil iar fïbronectin binding domain(RGD). three s ites 0 1' Ca ion binding motifs. cAMP- and cGMP-dep endent protein kinase phos phorylation site, two regions of protein kinase C phosphorylation s ites. glyco- saminoglycan attachment s ite ancl N-glycosylation site. transmembrane and Al kaline Phosphatase active s ite domains This newly iclentifï ed human protein from human choncl rocytes cDNA library appearecl to be related to a known calcification s ignaling protein. was named as Ca lsin(Ch276) . Ch153 appeared to be related a family of anti-microbial peptide acting as an inflammation mediator and Ch334 clone as a zinc finger protein whose expression in creases in human adult ti ssue‘ These results suggest that these novel genes ident i!ï ed from human chondrocytes rnay provide a new path 0 1' embryonic cartilage development and human craniofacial development.