A quantitative sequencing (QS) protocol that detects the frequencies of sodium channel mutations (M815I, T917I and L920F) responsible for knockdown resistance in permethrin-resistant head lice was tested as a population genotyping method. Genomic DNA fragments of the sodium channel α-subunit gene that encompass the three mutation sites were PCR-amplified from individual head lice with either resistant or susceptible genotypes, and combined together in various ratios to generate standard DNA template mixtures for QS. Following sequencing, the signal ratios between resistant and susceptible nucleotides were calculated and plotted against the corresponding resistance allele frequencies. Quadratic regression coefficients of the plots were close to 1, demonstrating that QS is highly reliable for the prediction of resistance allele frequencies. Prediction of resistance allele frequencies by QS in several globally collected lice samples including 12 Korean lice populations suggested that permethrin resistance varied substantially amongst different geographical regions. Three local populations of Korean lice were determined to have 9.8-36.7% resistance allele frequencies, indicating that an urgent resistance management is needed. QS should serve as a preliminary resistance monitoring tool for proper management strategies by allowing early resistance detection.
South Korean species of the bethylid wasps, genus Holepyris are reviewed. Ten species are recognized and eight of them are described as new to science: H. crinitus sp. nov., H. dimidium sp. nov., H. discedo sp. nov., H. mucro sp. nov., H. multo sp. nov., H. profundus sp. nov., H. secedo sp. nov., H. tantillus sp. nov.; Holepyris benten Terayama 2006 and H. susanowo Terayama 1999 are recorded for the first time from South Korea. Diagnostic characteristics and illustrations of each species are provided.
A total of 12 genera, 37 species in the subfamily Eumeninae was recognized from the insect collection of several universities and institute in Korea (Seoul National University, Kangwon National University, National institute of Agricultural Science & Tech.).
In 2007, 13 species in 9 genera were collected throughout the country by sweeping net and bamboo nest traps. Among them, Anterhynchium flavomarginatum koreanum (86 specimens), Discoelius zonalis (29 specimens), and Euodynerus dantici (20 specimens) were most dominant. One species (Stenodynerus sp.) was confirmed as new to science.
Using the bamboo nest traps, 7 species of Eumenid wasps were collected and the larvae of Gelechids and Pyralids were confirmed as the prey of Discoelius zonalis and Anterhynchium flavomarginatum koreanum, respectively.
Al thou gh it was reported that the human genome had been entirely seq uenced. so far there frequently appeared non - redundant cDNAs in gene cloning of cellular mRNAs. Consequently a lot of effort is required to ide ntified the new genes for theil‘ localization in chromosome and their functlons If the new genes had small size sequences 0 1' were expressed in low level , 5' RACE became ha rd unexpectedly. Here. we demonstrated a new method of 5’ RACE by PCR cloning using hair pin prime r and cDNA template produced by gene specific primer. Firstly .. total RNA obtained from tissue 0 1' cells is primed for rever se transcri ption (Superscript lI) by antisense primer (AS-l) specilïc to the objective gen e in order to produce single strand cDNAs The cDNAs usua lly have 3' overhanging of CCC seq uence. SeconcUy, a hail‘ pin primer overhang GGG seq uence in 3' end (i .e ‘ Tn'AGTGAGGGTTA AGAAGGAGAATTAACCCTCACTAAAGGG) is rnixed with the cDNA produced above, and 1'01- lowed by heating at 70'C for 5 min and cooled in room temperature to make hairpin-end template cDNAs Thirdly, For PCR is performed using the ha irpin-end template cDNAs and primer set of inner hairpin sense primer (i . e., TAACCCTCACTA AAGGGG) and AS-1 using pfu polymerase. And next. the PCR product can be directly sequenced 0 1' subcloned into vector to seq uence the purified plasrnid DNA. In our laboratory several unidentified new genes have been under investigation for theil‘ genomic l oci and functions. However. one of them. a human short helical protein 1 (hSHP-1) was a short gene less than 600 bp in s ize. encoding 45 amino acids . hSHP-1 is able to produce a potent antimicrobial peptide which has similar strength to magainin from frogs. The hSHP-1 also showed multifunctional roles of innate imrnunity including not only the ant imicrobial activity against methi cillin resistant strains but a lso anti- neoplastic effect on precance rous cell s . Fluorescence in situ hybricli zation in chromosome was not successful due to weak signal. and genornic Southern of hSHP-l showecl a higher weak bancl. which is not clearly definecl as an comrnon genomic locus‘ but could be cons idered its or igin from centromere region which contains less frequent restri ction sites. And more, th e ordinary PCR cloning performed pre vious ly from human genornic DNA produced only repetitive non-specific DNAs which were not matched to hSHP-l cDNA This study demonstrated how we have don e the PCR cl oning usi ng ha irpin primer and cDNA template reve rsely transcribed by gene specific primer.
om llnique miRNA encoding genes and also from intergene seqllences. 80 far it is generally suggestecl that one miRNA could target multiple genes. and also several miRNAs could be orchestrated to downregulate a s pecific gene. However. there would be many possibilities to procluce more miRNAs and to target gene in more compli catecl manners tha n we expected Here‘ we developed a detection program of miRNA consensus sequences from non- cocling region of genetic corcls As the ha irpin structure 01' tRNA has step-loop like hybridi zation by a single strand RNA. the repeated 3-5 nt symmetric arrangement with 6- 12 nt spanning sequences for hail‘pin head is necessary to form a preCllrsor rruRNA The DNA base pair‘ polarity program symbolizecl by the electrostatic polarities of pyrimidine and purine is now reinforcecl by the cletection program fOI symmetric DNA strand from non-coding regions. For example, we iclentifi ecl candidate miRNAs targeting eIF5A mRNA (miR-eIF5A-l)‘ 288 ribosomal RNA (miR- 28S-1). and dentin sialophosphate protein mRNA (miR- D8PP-1). 1n t his study the detection methocl of 288 ribosomal RNA was demonstrated ancl the molecular biological effects 01' miRNA targeting in vitro culture system were evaluatecl by miRNA RT• PCR, Northen blot, siRNA interference, and in situ hybridization. We firstly sea rched the candidate miRNA from the intron sequences of each objectiγe gene using the programs of syrrunetric sequence cletection a ncl DNA base pair polarity, ancl secondarily siRNA procluced by in vitro transcription and inclucible lenti virus vector cons tru ction was transfectecl into HEK293 cells. The transfectecl siRNA of miR-28S-1 was accumulated in the nucleoli ancl inclllced apoptosis extens ively in 2 days cultur8. Northern blot using miR-288-1 probe showed strong reaction in t he 288 bancJ of total RNA and also showed a smeared band in small size representing the presence of t he precursor and mature miRNAs 이 miR-288-1. In in situ hyridi zation most of cells revealed intensive miR-288-1 positive reaction in their cytopl asms. mirni cking t he abllndant localization of 288 RNA From the above study. we presume that rniRNAs targeting s pecific genes are possibly derivecl from the in tron seq uences of the objective gene, and suggest that the symmetirc sequence detect ion ancl DNA base pair polarity program is useflll to define the candiclate miRNA
The effect of cobalt precursor on the structure of Co supported multi-walled carbon nanotubes (MWCNTs) were studied by using X-ray photoelectron spectroscopy (XPS). MWCNTs were treated with a mixture of nitric and sulfuric acids and decorated with cobalt and/or cobalt oxides via aqueous impregnation solutions of cobalt nitrate or cobalt acetate followed by reduction in hydrogen. XPS was mainly used to investigate the phase of cobalt on MWCNTs after reduction with H2 flow at 400℃ for 2 h. Higher cobalt-nanoparticle dispersion was found in the MWCNTS prepared via cobalt nitrate decomposition. A typical XPS spectrum of Co 2p showed the peaks at binding energy (BE) values equal to 781 and 797 eV, respectively. It is found that cobalt nitrate supported MWCNTs is more dispersive and have catalytic activity than that of cobalt acetate supported MWCNTs at same preparation condition such as concentration of precursor solution and reduction environment.
Insulin-like growth factor II (IGF2) and H19 genes are mutually imprinted genes which may be responsible for abnormalities in the cloned fetuses and offspring. This study was performed to identify putative differentially methylated regions (DMRs) of porcine H19 locus and to explore its genomic imprinting in in vitro fertilized (IVF) and somatic cell nuclear transferred (SCNT) embryos. Based on mice genomic data, we identified DMRs on H19 and found porcine H19 DMRs that included three CTCF binding sites. Methylation patterns in IVF and SCNT embryos at the 2-, 4-, 8~16-cells and blastocyst stages were analyzed by BS (Bisulfite Sequencing)-PCR. The CpGs in CTCF1 was significantly unmethylated in the 2-cell stage IVF embryos. However, the 4- (29.1%) and 8~16-cell (68.2%) and blastocyst (48.2%) stages showed higher methylation levels (p<0.01). On the other hand, SCNT embryos were unmethylayted (0~2%) at all stages of development. The CpGs in CTCF2 showed almost unmethylation levels at the 2-, 4- and 8~16-cell and blastocyst stages of development in both IVF (0~14.1%) and SCNT (0~6.4%) embryos. At all stages of development, CTCF3 was unmethylated in IVF (0~17.3%) and SCNT (0~1.2%) embryos except at the blastocyst stage (54.5%) of IVF embryos. In conclusion, porcine SCNT embryos showed an aberrant methylation pattern comprised to IVF embryos. Therefore, we suggest that the aberrant methylation pattern of H19 loci may be a reason for increased abnormal fetus after embryo transfer of porcine SCNT embryos.