Al thou gh it was reported that the human genome had been entirely seq uenced. so far there frequently appeared non - redundant cDNAs in gene cloning of cellular mRNAs. Consequently a lot of effort is required to ide ntified the new genes for theil‘ localization in chromosome and their functlons If the new genes had small size sequences 0 1' were expressed in low level , 5' RACE became ha rd unexpectedly. Here. we demonstrated a new method of 5’ RACE by PCR cloning using hair pin prime r and cDNA template produced by gene specific primer. Firstly .. total RNA obtained from tissue 0 1' cells is primed for rever se transcri ption (Superscript lI) by antisense primer (AS-l) specilïc to the objective gen e in order to produce single strand cDNAs The cDNAs usua lly have 3' overhanging of CCC seq uence. SeconcUy, a hail‘ pin primer overhang GGG seq uence in 3' end (i .e ‘ Tn'AGTGAGGGTTA AGAAGGAGAATTAACCCTCACTAAAGGG) is rnixed with the cDNA produced above, and 1'01- lowed by heating at 70'C for 5 min and cooled in room temperature to make hairpin-end template cDNAs Thirdly, For PCR is performed using the ha irpin-end template cDNAs and primer set of inner hairpin sense primer (i . e., TAACCCTCACTA AAGGGG) and AS-1 using pfu polymerase. And next. the PCR product can be directly sequenced 0 1' subcloned into vector to seq uence the purified plasrnid DNA. In our laboratory several unidentified new genes have been under investigation for theil‘ genomic l oci and functions. However. one of them. a human short helical protein 1 (hSHP-1) was a short gene less than 600 bp in s ize. encoding 45 amino acids . hSHP-1 is able to produce a potent antimicrobial peptide which has similar strength to magainin from frogs. The hSHP-1 also showed multifunctional roles of innate imrnunity including not only the ant imicrobial activity against methi cillin resistant strains but a lso anti- neoplastic effect on precance rous cell s . Fluorescence in situ hybricli zation in chromosome was not successful due to weak signal. and genornic Southern of hSHP-l showecl a higher weak bancl. which is not clearly definecl as an comrnon genomic locus‘ but could be cons idered its or igin from centromere region which contains less frequent restri ction sites. And more, th e ordinary PCR cloning performed pre vious ly from human genornic DNA produced only repetitive non-specific DNAs which were not matched to hSHP-l cDNA This study demonstrated how we have don e the PCR cl oning usi ng ha irpin primer and cDNA template reve rsely transcribed by gene specific primer.

콩 품종 Essex와 PI 437654간 교잡 후 F2 유래 F3 계통들을 재료로 하여 작성된 RAPD 유전자지도상에 cyst 선충 race 5에 대한 저항성 QTLs 분석을 실시한 바 결과를 요약하면 다음과 같다. 1. 회귀분석 결과 26개의 marker들(22 RAPD, 4 RFLP)에서 cyst 선충 race 5 저항성 반응에 대한 유의성이 인정되었다. 2. MAPMAKER /QTL 분석 결과2개의 저항성 QTL들이 탐색되었는데, 이 QTL들은 2개의 linkage groups(LGC-20와 Group 2)에 위치하였다. 3. 탐색된 2개의 QTL들 중 1개는 우성유전, ？고 나머지 하나는 열성유전양상을 나타내었다. 4. 콩 cyst 선충 race 5의 저항성에 대한 유의성이 인정되는 5개의 marker들간 상호작용을 알아보기 위한 다중회귀분석 결과 총 26개의 조합들 중 4개의 marker들(E023 , G101 , W03, pK418C)로 구성된 조합에서 가장 높은 표리적 변이의 값(35.2%)을 나타내었다.