Protease from various sources have been studied biotecnologically. For biotechnological applications, one highly preferred enzyme is protease. There have been no reports of cloned genes encoding digestive proteases in the Laccotrephes japonenis, Ranatra unicolor, Muljarus japonicus. These insects are considered to be a predator of aquatic insects. RT-PCR was used to amplify cDNA fragments for digestive proteases from total RNA the hole body of the insects. The flanking sequences of the 5'- and 3'- end of the these genes were characterized by RACE-PCR. Sequence analysis showed that these genes contained complete ORF. The deduced amino acid sequences of these protease showed 62% identity to the serine protease of Creontiades dilutus, 58% to Lygus loneolaris trypsin-like serine proteinase, 54% to Triatonatoma infestans salivary trypsin. To generate Laccotrephes japonensis serine protease, the DNA fragment coding for serine protease is cloning into suttle vector pBACⅠ, named pBAC1-JG and infected to Spodoptera frugiperda (sf9) insect cell. The cDNA encoding JG was expressed as a 32-kDa polypeptide in baculovirus infected insect cells and the recombinant protein showed activity in the protease enzyme assay using gelatin as a substrate.
A glucose-regulated protein 78 (grp78) gene, which is belongs to a heat shock cognate 70 (hsc70) subfamily, was cloned from Indian meal moth, Plodia interpunctella. Its full length cDNA was 2679 bp and contains a 1980 bp open reading frame. The translated amino acid sequence consists of 660 residues with a calculated molecular mass of 72,975 Da and an isoelectronic point (pI) of 5.27. It contains several highly conserved functional motifs of the Hsp70 family and, particularly, C-terminal motif of KDEL that is characteristic for endoplasmic reticulum (ER) hsc70. Its deduced amino acid sequence shows a high identity (83-94%) with Hsc70s of other insects and grouped with Hsc70-3 among 5 Hsc70 members of Drosophila melanogaster. During development the grp78 transcript level was high in egg, feeding larval and adult stages but low in molting and wandering larval and pupal stages. Particularly its level was higher in the gut than integument and fat body of fifth instars. Furthermore its level was greatly decreased when fifth instar larvae were starved for 48 hrs but recovered at 3-6 hrs after re-fed diet. Our data suggests that grp78 is a member of hsc70 gene that belongs to ER and may have a role for energy metabolism at cellular level.
The morecular cloning, gene structure, expression and enzyme activity of a serine-like proteas frome Laccotrephes Japonensis were examined.
In this study, RT-PCR was used to amplify cDNA fragments for serine-like proteases from total RNA the hole body of Laccotrephes japonensis. The flanking sequences of the 5'- and 3'- end of the this gene were characterized by RACE-PCR. Sequence analysis showed that this gene contained an 963bp ORF encoding 321 amino acids. The deduced amino acid sequence of this protease showed 62% identity to the serine protease of Creontiades dilutus, 58% to Lygus loneolaris trypsin precuror LlsgP4, 54% to Triatonatoma infestans salivary trypsin.
To generate Laccotrephes japonensis serine-like protease, the DNA fragment coding for serine protease is cloning into suttle vector pBACⅠ, named pBAC1-JG and infected to Spodoptera frugiperda (sf9) insect cell. The cDNA encoding JG was expressed as a 32-kDa polypeptide in baculovirus infected insect cells and the recombinant JG showed activity in the protease enzyme assay using gelatin as a substrate.
Innate immunity responses are triggered by the immune challenge and therefore involve signaling processes. The cellular response is initiated by hemocytes and mainly involves phagocytosis and encapsulation of intruders by these cells. To address whether Hc-STAT is activated upon bacterial challenge, we examined the subcellular location of STAT protein in hemocyte by immunostaining. A new insect member of the STAT family of transcription factors (Hc-STAT) has been cloned from the lepidopteran, Hyphantria cunea. The domain involved in DNA interaction and the SH2 domain are well conserved. The gene is transcribed at a low level during all stages of development, and the protein is present in hemocytes, fat body, midgut, epidermis, and Malphigian tuble (Mt). Especially, hemocytes and Mt showed transcriptional activation of Hc-STAT upon Gram (-) bacteria and fungal challenge. Gram (-) bacteria and fungal challenge specifically results in nuclear translocation of Hc-STAT protein and induction of DNA-binding activity that recognizes a STAT target site in H. cunea hemocyte. In vitro treatment with pervanadate translocates Hc-STAT to the nucleus in hemocyte cells. Here we report the first evidence for the involvement hemocyte JAK/STAT pathway upon microbial infection in lepidopteran insect.
Phospholipase A2 (PLA2) is the committed catalytic step of eicosanoid biosynthesis, which has been a common molecular target of several entomopathogens to induce insect immunosuppression. Despite critical importance of PLA2 in insect immunity, its gene structure was not known. This study identified insect PLA2 gene associated with immune reactions in the red flour beetle, Tribolium castaneum. Based on a previous study that an immune-associated PLA2 in insect is secretory type of PLA2 (sPLA2), five highly matched cDNA sequences were obtained from T. castaneum genome database using an sPLA2 sequence probe encoded in Drosophila melanogaster. The expressions of these five putative PLA2 were confirmed by reverse transcriptase-polymerase chain reaction. Out of five genes, one PLA2 gene called TcPLA2B was chosen because it showed specific expression in hemocyte and fat body. TcPLA2B was cloned and expressed in Escherichia coli and its protein was purified. The purified TcPLA2B showed PLA2enzyme activity, which was specifically inhibited by bromophenacyl bromide (a specific sPLA2inhibitor) and dithiothreitol (reducing agent of disulfide bond). It was sensitive to pH (optimum at pH 6.0) and reaction temperature (optimum at 10-30°C), and calcium dependency. An immunofluorescence assay indicated that TcPLA2B was localized near to cellular membrane of the cytosol in the hemocytes of T. castaneum at immune chanlenge. Double-stranded RNA (dsRNA) of TcPLA2B-treated larvae showed knockdown of its mRNA expression and did not form hemocyte nodule formation, while control larvae could exhibit time- and bacterial dose-dependent nodule formation in response to bacterial challenge. Addition of arachidonic acid (the catalytic product of PLA2) to the dsRNA-treated larvae rescued the inhibition of nodule formation. These results suggest that TcPLA2B gene is associated with insect immune reaction.
Al thou gh it was reported that the human genome had been entirely seq uenced. so far there frequently appeared non - redundant cDNAs in gene cloning of cellular mRNAs. Consequently a lot of effort is required to ide ntified the new genes for theil‘ localization in chromosome and their functlons If the new genes had small size sequences 0 1' were expressed in low level , 5' RACE became ha rd unexpectedly. Here. we demonstrated a new method of 5’ RACE by PCR cloning using hair pin prime r and cDNA template produced by gene specific primer. Firstly .. total RNA obtained from tissue 0 1' cells is primed for rever se transcri ption (Superscript lI) by antisense primer (AS-l) specilïc to the objective gen e in order to produce single strand cDNAs The cDNAs usua lly have 3' overhanging of CCC seq uence. SeconcUy, a hail‘ pin primer overhang GGG seq uence in 3' end (i .e ‘ Tn'AGTGAGGGTTA AGAAGGAGAATTAACCCTCACTAAAGGG) is rnixed with the cDNA produced above, and 1'01- lowed by heating at 70'C for 5 min and cooled in room temperature to make hairpin-end template cDNAs Thirdly, For PCR is performed using the ha irpin-end template cDNAs and primer set of inner hairpin sense primer (i . e., TAACCCTCACTA AAGGGG) and AS-1 using pfu polymerase. And next. the PCR product can be directly sequenced 0 1' subcloned into vector to seq uence the purified plasrnid DNA. In our laboratory several unidentified new genes have been under investigation for theil‘ genomic l oci and functions. However. one of them. a human short helical protein 1 (hSHP-1) was a short gene less than 600 bp in s ize. encoding 45 amino acids . hSHP-1 is able to produce a potent antimicrobial peptide which has similar strength to magainin from frogs. The hSHP-1 also showed multifunctional roles of innate imrnunity including not only the ant imicrobial activity against methi cillin resistant strains but a lso anti- neoplastic effect on precance rous cell s . Fluorescence in situ hybricli zation in chromosome was not successful due to weak signal. and genornic Southern of hSHP-l showecl a higher weak bancl. which is not clearly definecl as an comrnon genomic locus‘ but could be cons idered its or igin from centromere region which contains less frequent restri ction sites. And more, th e ordinary PCR cloning performed pre vious ly from human genornic DNA produced only repetitive non-specific DNAs which were not matched to hSHP-l cDNA This study demonstrated how we have don e the PCR cl oning usi ng ha irpin primer and cDNA template reve rsely transcribed by gene specific primer.