Paired box protein, PAX7, is a key molecule for the specification, maintenance and skeletal muscle regeneration of muscle satellite cells. In this study, we identified and characterized the cDNA and amino acid sequences of PAX7 from black sea bream (Acanthopagrus schlegelii ) via molecular cloning and sequence analysis. A. schlegelii PAX7 cDNA was comprised of 1,524 bp encoding 507 amino acids and multiple sequence alignment analysis of the translated amino acids showed that it contained three domains including paired DNA-binding domain, homeobox domain and OAR domain which were well conserved across various animal species investigated. Pairwise Sequence Alignment indicated that A. schlegelii PAX7 had the same amino acid sequences with that of yellowfin seabream (A. latus ) and 99.8% identity and similarity with that of gilt-head bream (Sparus aurata ). Molecular phylogenetic analysis confirmed that A. schlegelii PAX7 formed a monophyletic group with those of teleost and most closely related with those of the fish that belong to Sparidae family including A. latus and S. aurata . In the investigation of its tissue specific mRNA expression, the expression was specifically identified in skeletal muscle tissue and a weak expression was also shown in gonad tissue. The cultured cells derived from skeletal muscle tissues expressed PAX7 mRNA at early passage but the expression was not observed after several times of subculture.

목화진딧물의 방제에 RNA interference(RNAi)를 이용하여 새로운 시각으로 새로운 방제를 시도하고자 한다. RNAi를 이용하여 목화진딧물의 방제에 이용할 target유전자들을 선발하기 위하여 gateway system을 이용한 목화진딧물 cDNA library를 제작하였다. 그 결과 RNAi에 적합한 약 100~400bp의 insert를 확인하였으며, blast search 및 EST database 비교분석 결과, 목화진딧물 관련 유전자임을 확인하였고, 최종적으로 8.4x105 titer의 목화진딧물 cDNA library를 완성하였다. 이러한 cDNA library는 att site를 가지는 TRV(Tobacco rattle virus) RNA2 vector에 LR recombination한 다음 Agrobacterium tumefacience(GV2260)에 transformation하였다. Agro-infiltration을 통하여 RNAi기작이 진단된 오이 에 목화진딧물을 접종하여 섭식시켰다. 섭식을 통한 살충 또는 기피효과를 bio-assay함으로써 target유전자를 선발하는 데 이용될 수 있을 것으로 사료된다.

Aphis gossypii was widely distributed throughout the tropical, subtropical and temperate zone. The chemical control of A. gossypii is becoming problem because it was rapidly appeared resistance expression to chemicals. We will attempt to resolve the this problem using RNAi technique. Besides, RNAi technology can be helpful to study the target genes of A. gossypii. In this study we produce cDNA library construction using gateway cloning system for selecting target gene in order to control of A. gossypii using RNAi. As a result, the 100-400bp of insert size, which is appropriate for RNAi was confirmed. Most of insert gene is associated with A. gossypii, after that insert sequence was compared with DNA databases and EST databases using NCBI blast search. Consequentially, A. gossypii of cDNA library with the titer of 3.15x105 clones were completed. And we will perform the LR recombination to transfer cDNA library into TRV2 (tobacco rattle virus) vector with att site. Then, after performing transformation using Agrobacterium tumefaciens (GV 2260), we inoculated to cucumber with A. tumefaciens. An insecticidal effect or a repellent activity against A. gossypii by changing behavior in transgenic cucumber plants were conformed. Also, the selecting target gene in order to control A. gossypii using RNAi may be provided.

A full-length lysozyme cDNA from Gryllotalpa orientalis was cloned and sequenced. The deduced amino acid sequence of the lysozyme protein was 143 amino acids in length, with a calculated molecular mass of 15.84 kDa and an isoelectric point of 4.74. Sequence motifs, together with alignment and phylogenetic results, confirmed that G. orientalis lysozyme belongs to the C (chicken)-type lysozyme family of proteins. The protein sequence of lysozyme from G. orientalis showed high identity to that of Drosophila melanogaster (51.7%); however, in contrast to D. melanogaster lysozyme, G. orientalis lysozyme was immune inducible and expressed in a wide range of tissues. Expression of G. orientalis lysozyme mRNA was highest at 8 h post-infection and subsequently decreased with time after bacterial infection. We also expressed G. orientalis lysozyme protein in vitro using the pET expression system. Compared with the negative control, over-expressed G. orientalis lysozyme showed antimicrobial activity against Gram-negative bacteria Escherichia coli and Gram-positive bacteria Bacillus subtilis by radial diffusion assay, with MIC values of 30.3 μM and 7.55 μM respectively. These results indicate that G. orientalis lysozyme may have stronger antimicrobial activity than other lysozymes against a broad range of microorganisms.

Eugenol은 많은 식물에서 eugenol synthase에 의해 생합성되는 phenylpropene 계통의 휘발성 화 합물이다. 그러나, 토마토 과실에서의 특징은 밝혀져 있지 않다. 이에 따라 토마토 ‘Micro-Tom'으로 부터 RACE 기법을 이용하여 완전장 cDNA를 클로닝 하여, SlEGS라 명명하였다. SlEGS의 open reading frame은 921bp로, 307개의 아미노산 서열을 갖는 단백질로 번역되었다. BLAST 결과에 따라 SlEGS는 PhEGS1 및 CbEGS2와 각 67.1, 69.4%의 높은 상동성을 갖는 것으로 나타났다. CLC genomics workbench 프로그램을 이용하여 SlEGS의 아미노산 구성을 분석하였고, Swiss-PDB viewer 프로그램에서 homology modeling 기법으로 SlEGS의 3차원 단백질 구조를 구축한 후 ProSA-web 툴로 3차원 구조의 안정성을 확인 하였다. 또한 ExPASy의 ProtParam 툴을 이용하여 SlEGS의 생리화학적 특성을 분석 하였다. SlEGS의 추정 분자량은 33.93kDA이고 등전점(pI)은 5.85 로 산성인 것으로 나타났다. 이와 더불어 SlEGS의 흡광 계수(EC), 불안정성 지수(II), alipathic 지수 (AI), GRAVY값 등의 생리화학적 특성에 대한 분석을 실시 하였다.

Diapause duration of Paratlanticus ussuriensis is prolonged as an egg that enter both initial and final diapause stgaes. Environmental conditions, such as temperature, can modify the duration of initial diapause. Eggs enter initial diapause at 20℃, but continued early embryonic development at 30℃. Final diapause at a fully developed embryonic stage is obligatory regardless of temperature conditions. To determine temperature effects on initial diapause mechanism of P. ussuriensis eggs, we compared weights, DNA and RNA amounts of eggs incubated at either 20℃ or 30℃ for 50 days after oviposition. We identified small heat shock protein (shsp), heat shock protein 90 (hsp90) and three heat shock protein 70 (hsp70a, hap70b, hsp70c) genes of P. ussuriensis and determined those expression levels at different temperature conditions. The levels of shsp, hsp70a, hsp70b and hsp90 was not detectable until 20 days after oviposition at both temperature conditions, but highly increased at 50 and 60 days when incubated at 30℃. In contrast, hsp70c level was rapidly peaked at 20 days after oviposition, which is the time of initial diapause entrance. We analysis of temperature sensitivity of P. ussuriensis eggs. Hsp70a is expressed after the first cold treatment of mature eggs. Hsp70b is highly expressed just before hatching. Both shsp and hsp70c was highly expressed at the heat shock condition into immature egg stage. Our results suggest that high temperature breakdown initial diapause and one hsp gene, such as hsp70c, may be involved into the mechanism of initial diapause of P. ussuriensis eggs.

Fungi belonging to the Paecilomyces spp. have recently been used as food and herbal medicines in Korea and are greatly popular as commercially available powdered supplement or dried fruiting body. Despite this acceptance and its use, little is known of the genes related to its reactive agents. Presently, We have constructed an olig-d(T) primed directional cDNA library from the silkworm Dongchunghacho, an entomopathogenic fungus, of which species is belonging to Paecilomyces spp. based on the previous identification of ITS1 and ITS2 at the molecular level and collected from Jocheon Miryang, Korea. To isolate and screen genes in the fungus, 626 expressed sequence tags(ESTs) were generated by a partial sequencing from the cDNA library. cDNA encoding the glyceraldehyde-3-phosphate dehydrogenase(Pt-GAPDH) of Paecilomyces tenuipes- Jocheon was cloned from the above cDNA library. The complete cDNA sequence of Pt-GAPDH is comprised of 1,014bp encoding 338 amino acid residues. The deduced protein sequence of Pt-GAPDH showed higher homology with Beauberia bassiana-GAPDH(93% amino acid identity). Hydropathy analysis revealed that Pt-GAPDH protein is hydrophilic. The major three amino acids in its composition of amino acid residues were alanine(11.54%), valine(9.47%) and glycine(8.88%). The Pt-GAPDH gene of Paecilomyces tenuipes entomopathogenic fungus consisted of three exons and two introns coding for 338 amino acid residues, and the genomic DNA length of the gene spans 1302bp. The accession number of the gene in GenBank are GU997099 for Pt-GAPDH cDNA and GU997102 for Pt-GAPDH genomic DNA. More investigation works including gene expression, immunological analysis etc. will be carried continuously without hesitation after this presentation.

Al thou gh it was reported that the human genome had been entirely seq uenced. so far there frequently appeared non - redundant cDNAs in gene cloning of cellular mRNAs. Consequently a lot of effort is required to ide ntified the new genes for theil‘ localization in chromosome and their functlons If the new genes had small size sequences 0 1' were expressed in low level , 5' RACE became ha rd unexpectedly. Here. we demonstrated a new method of 5’ RACE by PCR cloning using hair pin prime r and cDNA template produced by gene specific primer. Firstly .. total RNA obtained from tissue 0 1' cells is primed for rever se transcri ption (Superscript lI) by antisense primer (AS-l) specilïc to the objective gen e in order to produce single strand cDNAs The cDNAs usua lly have 3' overhanging of CCC seq uence. SeconcUy, a hail‘ pin primer overhang GGG seq uence in 3' end (i .e ‘ Tn'AGTGAGGGTTA AGAAGGAGAATTAACCCTCACTAAAGGG) is rnixed with the cDNA produced above, and 1'01- lowed by heating at 70'C for 5 min and cooled in room temperature to make hairpin-end template cDNAs Thirdly, For PCR is performed using the ha irpin-end template cDNAs and primer set of inner hairpin sense primer (i . e., TAACCCTCACTA AAGGGG) and AS-1 using pfu polymerase. And next. the PCR product can be directly sequenced 0 1' subcloned into vector to seq uence the purified plasrnid DNA. In our laboratory several unidentified new genes have been under investigation for theil‘ genomic l oci and functions. However. one of them. a human short helical protein 1 (hSHP-1) was a short gene less than 600 bp in s ize. encoding 45 amino acids . hSHP-1 is able to produce a potent antimicrobial peptide which has similar strength to magainin from frogs. The hSHP-1 also showed multifunctional roles of innate imrnunity including not only the ant imicrobial activity against methi cillin resistant strains but a lso anti- neoplastic effect on precance rous cell s . Fluorescence in situ hybricli zation in chromosome was not successful due to weak signal. and genornic Southern of hSHP-l showecl a higher weak bancl. which is not clearly definecl as an comrnon genomic locus‘ but could be cons idered its or igin from centromere region which contains less frequent restri ction sites. And more, th e ordinary PCR cloning performed pre vious ly from human genornic DNA produced only repetitive non-specific DNAs which were not matched to hSHP-l cDNA This study demonstrated how we have don e the PCR cl oning usi ng ha irpin primer and cDNA template reve rsely transcribed by gene specific primer.