본 연구에서는 식품 중 식물성 식품원료의 진위 판별을위하여 분자생물학적 기법을 이용한 판별법을 개발하였다.종 판별을 위한 유전자로 엽록체에 존재하는 matK 유전자와 핵 내에 존재하는 ITS 유전자 부분을 대상으로 하였으며, 가공식품에의 적용을 고려하여 PCR 산물의 크기는200bp 내외가 되도록 종 특이 프라이머(species-specificprimer)를 설계하였다. 대상종으로는 버섯류 6종(팽이버섯,표고버섯, 양송이버섯, 영지버섯, 새송이버섯 및 느타리버섯), 견과류 3종(밤, 잣 및 호두), 과실류 1종(대추), 채소류 6종(알로에, 미나리, 부추, 오이, 고추냉이 및 겨자), 콩류 2종(녹두, 팥) 및 기타 3종(과라나, 흰민들레 및 민들레), 총 21종을 선정하였으며, 종 특이 프라이머를 이용하여 예상되는 PCR 산물의 생성 유무를 확인하였다. PCR분석 결과, 21종의 식물성 식품원료에 대하여 각각 예상된 PCR 산물을 확인하였으며, 프라이머별로 비교종에서비 특이적 PCR 산물(non-specific PCR product)이 생성되지 않음을 확인하였다. 본 연구에서 개발된 종 특이 프라이머는 가열 및 가공된 식품 중 21종의 식물성 식품원료의 진위 판별에 이용될 것이며, 불량식품 근절에 적극 활용될 것으로 기대된다.

Using eight universal primers and new designed 315 species-specific primers, we tried to retrieve COI sequences from 45 dried specimens of 36 butterfly species collected from 1959 to 1980. The eight universal primers were entirely failed in PCR amplification and sequencing of all specimens. In the other hand, the 315 primers, targeting fragments of 71–417 bp, generated various lengths of COI sequences ranged from 444 bp to 658 bp from all specimens. Among 284 primer pairs, 26 primer pairs designed for Limenitis camilla, Argynnis niobe, and Brenthis daphne were success to produce COI sequences of congeneric speices, Limenitis doerriesi, Argynnis nerippe, and Brenthis ino. It suggests that the species-specific primers can be applied for analyzing COI sequences of closely related species. Our study reveals that newly designed species-specific primers will be effective to retrieval of COI sequences of old butterfly specimens.

In this study, a method was developed using molecular biological technique to distinguish an authenticity of meats for processed meat products. The genes for distinction of species about meats targeted at 12S or 16S genes in mitochondrial DNA and the species-specific primers were designed by that PCR products' size was around 200bp for applying to processed products. The target materials were 10 species of livestock products and it checked whether expected PCR products were created or not by electrophoresis after PCR using species-specific primers. The results of PCR for beef, pork, goat meat, mutton, venison, and horse meat were 131, 138, 168, 144, 191, and 142 bp each. The expected PCR products were confirmed at 281, 186, 174, and 238 bp for chicken, duck, turkeymeat, and ostrich. Also, non-specific PCR products were not detected in similar species by species-specific primers. The method using primers developed in this study confirm to be applicable for composite seasoning including beefs and processed meat products including pork and chicken. Therefore, this method may apply to distinguish an authenticity of meats for various processed products.

Al thou gh it was reported that the human genome had been entirely seq uenced. so far there frequently appeared non - redundant cDNAs in gene cloning of cellular mRNAs. Consequently a lot of effort is required to ide ntified the new genes for theil‘ localization in chromosome and their functlons If the new genes had small size sequences 0 1' were expressed in low level , 5' RACE became ha rd unexpectedly. Here. we demonstrated a new method of 5’ RACE by PCR cloning using hair pin prime r and cDNA template produced by gene specific primer. Firstly .. total RNA obtained from tissue 0 1' cells is primed for rever se transcri ption (Superscript lI) by antisense primer (AS-l) specilïc to the objective gen e in order to produce single strand cDNAs The cDNAs usua lly have 3' overhanging of CCC seq uence. SeconcUy, a hail‘ pin primer overhang GGG seq uence in 3' end (i .e ‘ Tn'AGTGAGGGTTA AGAAGGAGAATTAACCCTCACTAAAGGG) is rnixed with the cDNA produced above, and 1'01- lowed by heating at 70'C for 5 min and cooled in room temperature to make hairpin-end template cDNAs Thirdly, For PCR is performed using the ha irpin-end template cDNAs and primer set of inner hairpin sense primer (i . e., TAACCCTCACTA AAGGGG) and AS-1 using pfu polymerase. And next. the PCR product can be directly sequenced 0 1' subcloned into vector to seq uence the purified plasrnid DNA. In our laboratory several unidentified new genes have been under investigation for theil‘ genomic l oci and functions. However. one of them. a human short helical protein 1 (hSHP-1) was a short gene less than 600 bp in s ize. encoding 45 amino acids . hSHP-1 is able to produce a potent antimicrobial peptide which has similar strength to magainin from frogs. The hSHP-1 also showed multifunctional roles of innate imrnunity including not only the ant imicrobial activity against methi cillin resistant strains but a lso anti- neoplastic effect on precance rous cell s . Fluorescence in situ hybricli zation in chromosome was not successful due to weak signal. and genornic Southern of hSHP-l showecl a higher weak bancl. which is not clearly definecl as an comrnon genomic locus‘ but could be cons idered its or igin from centromere region which contains less frequent restri ction sites. And more, th e ordinary PCR cloning performed pre vious ly from human genornic DNA produced only repetitive non-specific DNAs which were not matched to hSHP-l cDNA This study demonstrated how we have don e the PCR cl oning usi ng ha irpin primer and cDNA template reve rsely transcribed by gene specific primer.

Recently, the importance of food safety is increasing due to numerous junk food. Junk food means to violate the law in stage such as production, manufacture, distribution, and sale of food. Many crop plants are processing as foods including bread, noodle, and other foods for supporting nutrition to human. For example, rice is one of the most well-known food crops in the world, and processed rice is being mixed with other processed crops to health food. The object of this study is to detect amount of specific grains, i.e. rice from processed foods mixed with other cereals. This experiment was performed to the following two steps: 1) designed the specific primer sets based on chloroplast DNAs, 2) amplified products using real-time PCR. We designed eleven primer sets within chloroplast DNA of rice, and then the confirmation of primer efficiency was to amplified with rice genomic DNA using real-time PCR. In addition, these primer sets were applied in other crops such as wheat, maize, and adlay to confirm specificity to rice. The rice specific primer sets were determined by the number of amplification and the melting peak through real-time PCR. As a result, five primer sets were confirmed to uniqueness in the rice genome. In conclusion, the specific primer sets would be useful for identifying rice grain from the processed foods to eliminate junk foods and for contribution of food safety.