Thermal emissivity of nuclear graphite was measured with its oxidation degree. Commercial nuclear graphites (IG-110, PECA, IG-430, and NBG-18) have been used as samples. Concave on graphites surface increased as its oxidation degree increased, and R value (Id/Ig) of the graphites decreased as the oxidation degree increased. The thermal emissivity increased depending on the decrease of the R (Id/Ig) value through Raman spectroscopy analysis. It was determined that the thermal emissivity was influenced by the crystallinity of the nuclear graphite.
The damage of citrus fruit by yellow tea thrips, Scirtothrips dorsalis Hood, was first confirmed in 2008, and has since been one of the serious pests of citrus in Jeju. This was reported on damage symptom on tangor cultivar, Setoka (Tangor Norin No. 8) fruits cultivated in a greenhouse and the characteristic of spatial disttribution of S. dorsalis caught on yellow sticky traps was conducted in three commercial citrus orchards. The feeding habits by S. dorsalis cause rind blemishes on the navel part of fruit. The damage is characterized by being scarped and figure like covered cloud on satsum mandarine fruit, but on by a brown ring of rough russeting that occurs on navel part of Setoka fruit. The season of damage occurrence was from middle of June to late of July. There was a highly significant relationship between the average number of thrips per trap and the maximum number caught on a trap. The overall differences between the linear regression models obtained from mean-variance relationship for each surveyed fields were tested by type Ⅲ error and contrast method. The characteristic of spatial distribution of S. dorsalis was better described by Taylor's power law than Iwao's patchiness regression, and the dispersion index which is the slope (=1.72) of linear regression model showed the aggregated distribution pattern. The sequential sampling stop lines at fixed precision level of 0.20, 0.25 and 0.30 were calculated.
Thermal emissivity of commercial nuclear graphites (IG-110, PCEA, IG-430 and NBG-18) following changes in oxidation degrees were examined. Specimens were oxidized to 0%, 5%, and 10% in air flow of 5l/min at 600℃ using a furnace, and the thermal emissivities were measured using an infrared spectrum analyzer. The measuring temperatures for the thermal emissivity were 100℃, 200℃, 300℃, 400℃ 500℃. Also density and porosity of the specimens were observed to compare with thermal emissivity. Results showed that emissivity increased with oxidation, and the 10% oxidized NBG-18 showed the highest emissivity (0.890) which value is larger for 24% than the value of as-received specimen. Investigation of factors affecting the emissivity revealed that increases in the surface roughness and porosity due to oxidation were responsible for the increase in emissivity after oxidation.
A CNT-TiO2 nano composite was prepared from titanium chloride (TiCl4) via sol-gel process using multi walled carbon nano tube (MWCNT) followed by calcination at 450℃. Spectral analysis revealed that the formed TiO2 resided on the carbon in anatase form. The effect of adsorption was investigated using aqueous solution of methylene blue and procion blue dye. The photochemical reaction of CNT-TiO2 composite in aqueous suspensions was studied under UV illumination in batch process. The reaction was investigated by monitoring the discoloration of the dyes employing UV-Visible spectro-photometeric technique as a function of irradiation time. The catalyst composites were found to be efficient for the photodegradation of the dye.
Al thou gh it was reported that the human genome had been entirely seq uenced. so far there frequently appeared non - redundant cDNAs in gene cloning of cellular mRNAs. Consequently a lot of effort is required to ide ntified the new genes for theil‘ localization in chromosome and their functlons If the new genes had small size sequences 0 1' were expressed in low level , 5' RACE became ha rd unexpectedly. Here. we demonstrated a new method of 5’ RACE by PCR cloning using hair pin prime r and cDNA template produced by gene specific primer. Firstly .. total RNA obtained from tissue 0 1' cells is primed for rever se transcri ption (Superscript lI) by antisense primer (AS-l) specilïc to the objective gen e in order to produce single strand cDNAs The cDNAs usua lly have 3' overhanging of CCC seq uence. SeconcUy, a hail‘ pin primer overhang GGG seq uence in 3' end (i .e ‘ Tn'AGTGAGGGTTA AGAAGGAGAATTAACCCTCACTAAAGGG) is rnixed with the cDNA produced above, and 1'01- lowed by heating at 70'C for 5 min and cooled in room temperature to make hairpin-end template cDNAs Thirdly, For PCR is performed using the ha irpin-end template cDNAs and primer set of inner hairpin sense primer (i . e., TAACCCTCACTA AAGGGG) and AS-1 using pfu polymerase. And next. the PCR product can be directly sequenced 0 1' subcloned into vector to seq uence the purified plasrnid DNA. In our laboratory several unidentified new genes have been under investigation for theil‘ genomic l oci and functions. However. one of them. a human short helical protein 1 (hSHP-1) was a short gene less than 600 bp in s ize. encoding 45 amino acids . hSHP-1 is able to produce a potent antimicrobial peptide which has similar strength to magainin from frogs. The hSHP-1 also showed multifunctional roles of innate imrnunity including not only the ant imicrobial activity against methi cillin resistant strains but a lso anti- neoplastic effect on precance rous cell s . Fluorescence in situ hybricli zation in chromosome was not successful due to weak signal. and genornic Southern of hSHP-l showecl a higher weak bancl. which is not clearly definecl as an comrnon genomic locus‘ but could be cons idered its or igin from centromere region which contains less frequent restri ction sites. And more, th e ordinary PCR cloning performed pre vious ly from human genornic DNA produced only repetitive non-specific DNAs which were not matched to hSHP-l cDNA This study demonstrated how we have don e the PCR cl oning usi ng ha irpin primer and cDNA template reve rsely transcribed by gene specific primer.
om llnique miRNA encoding genes and also from intergene seqllences. 80 far it is generally suggestecl that one miRNA could target multiple genes. and also several miRNAs could be orchestrated to downregulate a s pecific gene. However. there would be many possibilities to procluce more miRNAs and to target gene in more compli catecl manners tha n we expected Here‘ we developed a detection program of miRNA consensus sequences from non- cocling region of genetic corcls As the ha irpin structure 01' tRNA has step-loop like hybridi zation by a single strand RNA. the repeated 3-5 nt symmetric arrangement with 6- 12 nt spanning sequences for hail‘pin head is necessary to form a preCllrsor rruRNA The DNA base pair‘ polarity program symbolizecl by the electrostatic polarities of pyrimidine and purine is now reinforcecl by the cletection program fOI symmetric DNA strand from non-coding regions. For example, we iclentifi ecl candidate miRNAs targeting eIF5A mRNA (miR-eIF5A-l)‘ 288 ribosomal RNA (miR- 28S-1). and dentin sialophosphate protein mRNA (miR- D8PP-1). 1n t his study the detection methocl of 288 ribosomal RNA was demonstrated ancl the molecular biological effects 01' miRNA targeting in vitro culture system were evaluatecl by miRNA RT• PCR, Northen blot, siRNA interference, and in situ hybridization. We firstly sea rched the candidate miRNA from the intron sequences of each objectiγe gene using the programs of syrrunetric sequence cletection a ncl DNA base pair polarity, ancl secondarily siRNA procluced by in vitro transcription and inclucible lenti virus vector cons tru ction was transfectecl into HEK293 cells. The transfectecl siRNA of miR-28S-1 was accumulated in the nucleoli ancl inclllced apoptosis extens ively in 2 days cultur8. Northern blot using miR-288-1 probe showed strong reaction in t he 288 bancJ of total RNA and also showed a smeared band in small size representing the presence of t he precursor and mature miRNAs 이 miR-288-1. In in situ hyridi zation most of cells revealed intensive miR-288-1 positive reaction in their cytopl asms. mirni cking t he abllndant localization of 288 RNA From the above study. we presume that rniRNAs targeting s pecific genes are possibly derivecl from the in tron seq uences of the objective gene, and suggest that the symmetirc sequence detect ion ancl DNA base pair polarity program is useflll to define the candiclate miRNA
The effect of cobalt precursor on the structure of Co supported multi-walled carbon nanotubes (MWCNTs) were studied by using X-ray photoelectron spectroscopy (XPS). MWCNTs were treated with a mixture of nitric and sulfuric acids and decorated with cobalt and/or cobalt oxides via aqueous impregnation solutions of cobalt nitrate or cobalt acetate followed by reduction in hydrogen. XPS was mainly used to investigate the phase of cobalt on MWCNTs after reduction with H2 flow at 400℃ for 2 h. Higher cobalt-nanoparticle dispersion was found in the MWCNTS prepared via cobalt nitrate decomposition. A typical XPS spectrum of Co 2p showed the peaks at binding energy (BE) values equal to 781 and 797 eV, respectively. It is found that cobalt nitrate supported MWCNTs is more dispersive and have catalytic activity than that of cobalt acetate supported MWCNTs at same preparation condition such as concentration of precursor solution and reduction environment.
[n order to obtain the trlle expected DNA prod uct from PCR and RT-PCR using genornic DNA or cDNA reversely transcribed from mRNA. the PCR should be done in an appropriated condition. Sometimes the PCR was repeatedly fail ed. and cventllally the PCR product was turned out to be nonspecific and rudimentary . And more‘ t he PCR prodllctwas not reproducible even though careflll repeat of experiments. As the PCR was based on the exact primel hybridization. the condition of primer hybridization should be properly controlled by a nnealing temperatllre. But the selection of primer seqllences for targeting a specific gene is mostly important. A new method of primer eval uation is now available llsing DNA base pair polarity program. This study presents an example of PCR targeting to human Bax gene using genomic DNA. The DNA base pair polarity theory can di vide the genetic cord into propel DNA segments and calclllaLe their DNA base pair hybridization energy. Thus. mathematically the degree 0(' exact primer hybridization can be expected for the t r1l8 targeting of PCR. However, the DNA base pair polal'ityanalysis demonstrates that the more frequent number of DNA segment incl'eased the specificity of PCR. but decreased its sensitivity . While the greater polarity of DNA segment composed of increased nllmber of polarized DNA base pairs showed increased sensitivi ty 0 1' PCR. bllt relati vely decreased specificity of PCR. With the mllltiple analysis of PCR. especially for PCR cloning from the gDNA and cDNA, we found that the primers themselves showed secondary strllcture of partial hybridization between sameprimers or each pair primers. The DNA base pail‘ polarity signal can directly demonstrated symmetric sequences 0 1' each primer. and also can distinguish the dimmer formation from each pair primers. At least the symmetric seqllence of fOlll‘ base pairs dramatically showed the dimrner formation. On the other hand. in addi tion Lo the statlls of DNA base pair polarity the three-dimensional strllctllre of DNA dOllble helix targeted by the primer seqllences may affect the sensitivity and specificity of PCR detection. The present study introduced a new method of primer evalllation and selection in order to obtain abundant and exacL! y-trlle DNA product for genomic ffilltation analysis and gene expression profï le
Mitis-salivarius sucrose bacitracin(MSB) medium is widely used in the selective isolation of mutans streptococci(MS), a designation for a group of oral cariogenic species. Recently, we have isolated three bacterial strains grown on MSB agar from human dental plaques. The three strains exhibited biochemical characteristics similar to those of the biotype IV of MS, with the exception that they manifested a positive reaction for arginine deaminase. The objective of this study was to identify and characterize these three clinical isolates. The bacteria were identified with biochemical tests as well as by 16S rDNA cloning and sequencing. In order to compare the antibiotics susceptibility of the clinical isolates with that of type strain, the minimum inhibitory concentrations of 9 antibiotics were determined using broth dilution assays. The results identified all of our three clinical isolates as Enterococcus faecalis. All E. faecalis strains were found to be susceptible to penicillin G, amoxicillin, augmentin, and vancomycin, but were resistant to ciprofloxacin, cefuroxim axetil, and clindamycin. Our findings indicate that E. faecalis is capable of growing on MSB agar, and suggest that the MSB medium be improved so that only MS should be recoverable on the medium, as originally devised for their selection.
Immuno-MemBlot is a technique for detecting, analyzing, and identifying proteins, similar to the Western blot technique but differing in that protein samples are not separated electrophoretically but are spotted through circular or slot templates directly onto the membrane. Recently we developed a new Immuno-MemBlot (IMB) method applying immunoreactions and coloring procedures directly in the wells of MemBlot apparatus, which were connected by canals to perform drainage for reagent application and buffer irrigation. This IMB method was designed to get theimmunoblot results more rapidly and clearly than the previous immunoblot ones. This study is aimed to evaluate the analytical accuracy of IMB using different biological assay. In the sensitivity test of IMB the monoclonal antibody can clearly detect the 30 ng (about 12 pM) of Mucocidin peptide (35 mer), and is also available to detect at least 10 ng (about 4 pM) of Mucocidin peptide (35 mer). The IMB was effective in the quantitative analysis of methothrexate (MTX) assay for cellular apoptosis. And more, this IMB is useful to screen large number of specific samples with ease and accuracy in a short time. In the screenings for the presence of Mucocidin in saliva the quantitative comparison is conspicuous among 48 persons depend on the different conditions ofgender, drinking and smoking habits, and oral diseases. Therefore, it is presumed that, even though the target proteins were partly degraded, a specific epitope can be detected if a monoclonal antibody was still reactive. Conclusively, these data suggest that the IMB can be useful in the primary qualitativeand quantitative analysis of proteins in various fluids, i.e., blood, saliva, tear, urine, etc.
Gene reg비 at i o n during the human craniofacial development is not well understood In effort to understand n ewly identifï ed genes that may play role(s) in the human craniofacial development, non-redundan t genes were isolated from the s ubtracted cDNA libra ry of human embryonal craniofacial tissues and examined their possible structu ral rolc in parallcl with thosc gcncs from isolatecl human c h o nclroc)πes cDNA library. Fifty genes were init ia ll y chosen from 398 clones iso latecl were used for selective dominant expression in both chondrocytes and the craniofacial sections of 10 weeks old human embryo by in situ hybridization method. Based upon the high levels 。f expression, we have identifi ecl seven unknown genes; ch89, ch96. ch129. ch 153. ch 276 ch285. and ch334 . In 。rder to unde rs tancl the possi ble role of these genes‘ the structural simulation of the expressed proteins were constructecl by Sybyl 6.6 program. Ch 276 gene was same with a clone, c14 0 1' f173. registered in GenBank(NM_022489) a nd is composed 0 1' 323 amino acids having a reverse s ignaling domain from the extra- cellular matrix(C-terminal) to cell membrane(N-terminal) and 12 turns of helical structure. Gene protein also r etains a famil iar fïbronectin binding domain(RGD). three s ites 0 1' Ca ion binding motifs. cAMP- and cGMP-dep endent protein kinase phos phorylation site, two regions of protein kinase C phosphorylation s ites. glyco- saminoglycan attachment s ite ancl N-glycosylation site. transmembrane and Al kaline Phosphatase active s ite domains This newly iclentifï ed human protein from human choncl rocytes cDNA library appearecl to be related to a known calcification s ignaling protein. was named as Ca lsin(Ch276) . Ch153 appeared to be related a family of anti-microbial peptide acting as an inflammation mediator and Ch334 clone as a zinc finger protein whose expression in creases in human adult ti ssue‘ These results suggest that these novel genes ident i!ï ed from human chondrocytes rnay provide a new path 0 1' embryonic cartilage development and human craniofacial development.
Hemangiomas are different from true vascular malformations in thei l‘ pathogenesis and cl inical prognosis. There are sti ll no standardized antibodies to distinguish hemangioma and vascular malformation apparently. We compared juvenile hemangioma and vascular malformation with immunohistochemjstry using va ri OllS antibodies, i.e. , ANG, bFGF, VEGF. EGFR, vWF. PCNA. p53. maspin, and TNF- . A very st rong positive expression of ANG and vWF was observed mainly in the vascular endothelial cells of juvenile hemangioma. VEGF s howed st rong positive reaction in the juveni le hemangioma, but p53 showed no positive reaction. Ancl a strong positive reaction of ANG was observed in the vascular endothelial walls of vascular malformation. p53 was frequently positive in the lining endothel ial cells in the vascular malformatJOn Using a ntiboclies such as VEG F'. ANG. vWF which a re related to the proliferation and matllrity of the vessel components. and p53 antibodies in order to confirm between juvenile hemangioma and vascular malformation would be helpful