Caliber persistent artery (CPA) is a vascular anomaly presenting as a bluish and pulsatile artery in the subepithelial tissue. Although the incidence of CPA was debated, many CPAs occurred in the perioral and facial tissues at which the embryonal strapedial artery networks were distributed. The present study demonstrated a case of CPA occurred in the retromolar buccal mucosa in a 37 years old male. The lesion showed many pinkish granular spots, but was asymptomatic except biting irritation during mastication. It had slowly increased in size up to 20 × 25 mm for 3 years, and recently became hemorrhagic due to the biting injury between left upper and lower second molars. With the fear of oral cancer an incisional biopsy was performed, and followed by histological and immunohistochemical study. Histologically the lesion showed many tortuous artery localized at the submucosa area, and the arterial wall was thick and its lumen was narrowed and shrunken. In the immunochemistry α-SMA was positive for thick smooth muscle layer of artery and arterioles, TGase 2 was weakly positive for the luminal surface of arterial intima, and bFGF was consistently positive for the perivascular fibrous tissue. But PCNA, VEGF, CD31, CMG2, TGF-β1, HSP-70, and 14-3-3 were almost negative for the vascular tissue. Therefore, it was presumed that the lesion was not actively proliferative nor degenerative but still retained its cellular stability and slow growing potential. It was finally diagnosed as CPA differentially from arterio-venous malformation, hemangioma, lymphangioma, and squamous cell carcinoma. The retromolar buccal mucosa CPA is first reported in this study and may present usual clinical findings depending on its size and location. This asymptomatic lesion could be severely hemorrhagic by minor biting injury, therefore, precise differential diagnosis should be made through biopsy, and careful therapy be followed.
Some euryalid specimens were collected with fishing nets from Mipo, Gyungsangnamdo and Aewol, Jejudo Island, Korea. They were identified as Gorgonocephalus eucnemis (Müller & Troschel, 1842), belonging to family Gorgonocephalidae of order Euryalida, which was new to the Korean fauna. Their molecular analyses were done with newly intended COI primers of mitochondrial cytochrome oxidase I (COI) gene for the accurate molecular identification. The Korean G. eucnemis was coincident with this NCBI species as a result of Blast analysis, which showed the 99% similarity. In the current study, three Gorgonocephalus species have been reported from Korea.
A sea urchin was collected from 140 m deep at Gapado which is nearby Moseulpo in Jejudo Island, Korea on 30 June 2010. This specimen was classified as Echinolampas koreana H.L. Clark 1925, belonging to family Echinolampadidae of order Echinolampadoida based on its morphological characteristics. This order and lower categories are newly recorded from Korea. Distinct morphological characters of this species are as follows: test is relatively high. Abactical system has four large genital pores. Periproct is slightly sunken and situated below equator line. Peristome is very small and rather deeply sunken. Tridentate and ophiocephalous pedicellariae are present. Color in alcohol is light purple. These morphological characters are re-described with illustrations.
Asteroid specimens were collected from Shinnam, Gangwondo in the East Sea of Korea with fishing nets on 12 September 2014. The specimens were identified as Henricia reticulata Hayashi, 1940, belonging to family Echinasteridea of order Spinulosida. This species can be distinguished by a larger disc and broader arms compared to those other Henricia species. The morphological characteristics of this species are re-described with illustrations. By previous work of this genus, six species have been reported in the Korean fauna.
A 57 years old female received xenogenic bone graft for the extraction socket augmentation of right maxillary molars and for the sinus floor elevation six months ago. The bone graft sites were healed uneventfully and showed marked radiopacity in the postoperative X-ray view. Before dental implant insertion the bone biopsy was made using trephine bur and examined pathologically. The graft bones showed minimum new bone deposition with dysplastic epithelium. The epithelium was proliferative on the surface of graft bones forming epithelial strands and nests, similar to the odontogenic epithelium. The immunohistochemical study was performed using different antisera of odontogenic markers, growth factors, oncogenes, etc. The epithelial cells were strongly positive for pan-keratins, EGF, pAKT, and HSP-70, consistently positive for PCNA, p53, EGFR, 14-3-3, and survivin, slightly positive for ameloblastin, but rarely positive for amelogenin. Particularly the matrix of graft bone was slightly positive for EGF. Taken together, it is presumed that the abnormal epithelium on the graft bones was derived from odontogenic epithelial elements, Malassez epithelial rests, distributed at the periodontal tissue of maxillary molars, and that they might undergo dysplastic proliferation affected by the release of growth factors and osteogenic proteins from the graft bones. It is also suggested that the graft bone substitutes inserted for the dental implant possibly have a potential to induce the proliferation of odontogenic epithelial rests leading to the pathogenesis of odontogenic cysts and tumors.
Lacticin NK34 is a small nisin-like bacteriocin present in the supernatants of an isolate of Lactococcus lactis from jeotgal, a salted and fermented Korean food made with seafood such as shrimp, oysters, and fish. Recently, we demonstrated that a partially purified NK34 is highly effective against various Staphylococcus species in a murine infection model. In this study, the two major bacterial pathogens associated with bovine mastitis, Streptococcus aureus and S. agalactiae, were evaluated for their susceptibility to NK34 in vitro using a standard teat-dip assay as well as in vivo using mastitic cows infected with one of these pathogenic strains. The experimental analyses showed a significant decrease (up to 98 times) in the bacterial numbers between the NK34-treated and -untreated teats. Moreover, a dramatic reduction in somatic cell counts was observed at 3 days post-treatment with 10 ml of NK34 administered directly into the mastitic cows. Neither S. aureus nor S. agalactiae were recovered. Taken together, these results imply that lacticin NK34 is an alternative antimicrobial substitute for the treatment of bovine mastitis, caused especially by either S. aureus or S. agalactiae.
This study aims to compared effect of balance between general walking exercise and power walking exercise. Twenty subjects were classified into two groups, general walking exercise(n=10) and power walking exercise(n=10). As a result, two group showed difference within the group and there is significant difference between two groups. 1) In compared static balance of sway area at pre-post test to exercise group, general walking exercise group did not change significantly. however, power walking exercise group did change significantly. and At sway distance, two group showed significant changes. 2) In compared Static balance between the groups sway area and sway path at pre-post test, two group showed significant changes. 3) In compared dynamic balance of center distance at pre-post test to exercise group, general walking exercise group was no significant difference in all directions. power walking exercise group was significant difference in all directions. 4) In compared dynamic balance between the groups sway area and sway path at pre-post test, there was no significant difference in leftward, rightward, forward directions and was significant difference in backward, overall direction. Therefore, power walking exercise can be recommended promote balance.
Al thou gh it was reported that the human genome had been entirely seq uenced. so far there frequently appeared non - redundant cDNAs in gene cloning of cellular mRNAs. Consequently a lot of effort is required to ide ntified the new genes for theil‘ localization in chromosome and their functlons If the new genes had small size sequences 0 1' were expressed in low level , 5' RACE became ha rd unexpectedly. Here. we demonstrated a new method of 5’ RACE by PCR cloning using hair pin prime r and cDNA template produced by gene specific primer. Firstly .. total RNA obtained from tissue 0 1' cells is primed for rever se transcri ption (Superscript lI) by antisense primer (AS-l) specilïc to the objective gen e in order to produce single strand cDNAs The cDNAs usua lly have 3' overhanging of CCC seq uence. SeconcUy, a hail‘ pin primer overhang GGG seq uence in 3' end (i .e ‘ Tn'AGTGAGGGTTA AGAAGGAGAATTAACCCTCACTAAAGGG) is rnixed with the cDNA produced above, and 1'01- lowed by heating at 70'C for 5 min and cooled in room temperature to make hairpin-end template cDNAs Thirdly, For PCR is performed using the ha irpin-end template cDNAs and primer set of inner hairpin sense primer (i . e., TAACCCTCACTA AAGGGG) and AS-1 using pfu polymerase. And next. the PCR product can be directly sequenced 0 1' subcloned into vector to seq uence the purified plasrnid DNA. In our laboratory several unidentified new genes have been under investigation for theil‘ genomic l oci and functions. However. one of them. a human short helical protein 1 (hSHP-1) was a short gene less than 600 bp in s ize. encoding 45 amino acids . hSHP-1 is able to produce a potent antimicrobial peptide which has similar strength to magainin from frogs. The hSHP-1 also showed multifunctional roles of innate imrnunity including not only the ant imicrobial activity against methi cillin resistant strains but a lso anti- neoplastic effect on precance rous cell s . Fluorescence in situ hybricli zation in chromosome was not successful due to weak signal. and genornic Southern of hSHP-l showecl a higher weak bancl. which is not clearly definecl as an comrnon genomic locus‘ but could be cons idered its or igin from centromere region which contains less frequent restri ction sites. And more, th e ordinary PCR cloning performed pre vious ly from human genornic DNA produced only repetitive non-specific DNAs which were not matched to hSHP-l cDNA This study demonstrated how we have don e the PCR cl oning usi ng ha irpin primer and cDNA template reve rsely transcribed by gene specific primer.
om llnique miRNA encoding genes and also from intergene seqllences. 80 far it is generally suggestecl that one miRNA could target multiple genes. and also several miRNAs could be orchestrated to downregulate a s pecific gene. However. there would be many possibilities to procluce more miRNAs and to target gene in more compli catecl manners tha n we expected Here‘ we developed a detection program of miRNA consensus sequences from non- cocling region of genetic corcls As the ha irpin structure 01' tRNA has step-loop like hybridi zation by a single strand RNA. the repeated 3-5 nt symmetric arrangement with 6- 12 nt spanning sequences for hail‘pin head is necessary to form a preCllrsor rruRNA The DNA base pair‘ polarity program symbolizecl by the electrostatic polarities of pyrimidine and purine is now reinforcecl by the cletection program fOI symmetric DNA strand from non-coding regions. For example, we iclentifi ecl candidate miRNAs targeting eIF5A mRNA (miR-eIF5A-l)‘ 288 ribosomal RNA (miR- 28S-1). and dentin sialophosphate protein mRNA (miR- D8PP-1). 1n t his study the detection methocl of 288 ribosomal RNA was demonstrated ancl the molecular biological effects 01' miRNA targeting in vitro culture system were evaluatecl by miRNA RT• PCR, Northen blot, siRNA interference, and in situ hybridization. We firstly sea rched the candidate miRNA from the intron sequences of each objectiγe gene using the programs of syrrunetric sequence cletection a ncl DNA base pair polarity, ancl secondarily siRNA procluced by in vitro transcription and inclucible lenti virus vector cons tru ction was transfectecl into HEK293 cells. The transfectecl siRNA of miR-28S-1 was accumulated in the nucleoli ancl inclllced apoptosis extens ively in 2 days cultur8. Northern blot using miR-288-1 probe showed strong reaction in t he 288 bancJ of total RNA and also showed a smeared band in small size representing the presence of t he precursor and mature miRNAs 이 miR-288-1. In in situ hyridi zation most of cells revealed intensive miR-288-1 positive reaction in their cytopl asms. mirni cking t he abllndant localization of 288 RNA From the above study. we presume that rniRNAs targeting s pecific genes are possibly derivecl from the in tron seq uences of the objective gene, and suggest that the symmetirc sequence detect ion ancl DNA base pair polarity program is useflll to define the candiclate miRNA
[n order to obtain the trlle expected DNA prod uct from PCR and RT-PCR using genornic DNA or cDNA reversely transcribed from mRNA. the PCR should be done in an appropriated condition. Sometimes the PCR was repeatedly fail ed. and cventllally the PCR product was turned out to be nonspecific and rudimentary . And more‘ t he PCR prodllctwas not reproducible even though careflll repeat of experiments. As the PCR was based on the exact primel hybridization. the condition of primer hybridization should be properly controlled by a nnealing temperatllre. But the selection of primer seqllences for targeting a specific gene is mostly important. A new method of primer eval uation is now available llsing DNA base pair polarity program. This study presents an example of PCR targeting to human Bax gene using genomic DNA. The DNA base pair polarity theory can di vide the genetic cord into propel DNA segments and calclllaLe their DNA base pair hybridization energy. Thus. mathematically the degree 0(' exact primer hybridization can be expected for the t r1l8 targeting of PCR. However, the DNA base pair polal'ityanalysis demonstrates that the more frequent number of DNA segment incl'eased the specificity of PCR. but decreased its sensitivity . While the greater polarity of DNA segment composed of increased nllmber of polarized DNA base pairs showed increased sensitivi ty 0 1' PCR. bllt relati vely decreased specificity of PCR. With the mllltiple analysis of PCR. especially for PCR cloning from the gDNA and cDNA, we found that the primers themselves showed secondary strllcture of partial hybridization between sameprimers or each pair primers. The DNA base pail‘ polarity signal can directly demonstrated symmetric sequences 0 1' each primer. and also can distinguish the dimmer formation from each pair primers. At least the symmetric seqllence of fOlll‘ base pairs dramatically showed the dimrner formation. On the other hand. in addi tion Lo the statlls of DNA base pair polarity the three-dimensional strllctllre of DNA dOllble helix targeted by the primer seqllences may affect the sensitivity and specificity of PCR detection. The present study introduced a new method of primer evalllation and selection in order to obtain abundant and exacL! y-trlle DNA product for genomic ffilltation analysis and gene expression profï le
Immuno-MemBlot is a technique for detecting, analyzing, and identifying proteins, similar to the Western blot technique but differing in that protein samples are not separated electrophoretically but are spotted through circular or slot templates directly onto the membrane. Recently we developed a new Immuno-MemBlot (IMB) method applying immunoreactions and coloring procedures directly in the wells of MemBlot apparatus, which were connected by canals to perform drainage for reagent application and buffer irrigation. This IMB method was designed to get theimmunoblot results more rapidly and clearly than the previous immunoblot ones. This study is aimed to evaluate the analytical accuracy of IMB using different biological assay. In the sensitivity test of IMB the monoclonal antibody can clearly detect the 30 ng (about 12 pM) of Mucocidin peptide (35 mer), and is also available to detect at least 10 ng (about 4 pM) of Mucocidin peptide (35 mer). The IMB was effective in the quantitative analysis of methothrexate (MTX) assay for cellular apoptosis. And more, this IMB is useful to screen large number of specific samples with ease and accuracy in a short time. In the screenings for the presence of Mucocidin in saliva the quantitative comparison is conspicuous among 48 persons depend on the different conditions ofgender, drinking and smoking habits, and oral diseases. Therefore, it is presumed that, even though the target proteins were partly degraded, a specific epitope can be detected if a monoclonal antibody was still reactive. Conclusively, these data suggest that the IMB can be useful in the primary qualitativeand quantitative analysis of proteins in various fluids, i.e., blood, saliva, tear, urine, etc.
The primary growth center (MdPGC) of human fetal mandible was conspicuously distinguished in the soft X-ray view of fetal mandibles.1) As the peripheral adaptive growth of mandible advanced during the postnatal period, the MdPGC became overshadowed by condensed cortical bone. However, in the well-processed radiograms of adult mandible a condensed radiopaque image, measuring 0.5-1.0 cm in diameter, can be observed below the apex of first premolar. In this study we aimed to trace a sclerotic sequela of mandibular primary growth center during postnatal period. Panoramic radiograms of two hundreds adults and soft X-ray views of thirty dry mandible were analyzed by statistical methods. The adult MdPGC was clearly distinguishable from the mental foramen. The area of MdPGC was seldom changed in the older persons, even in the edentulous mandibles. Additionally, the benign lesions of odontogenic cysts and tumors hardly destroyed the original structure of MdPGC, while the malignant tumors of squamous cell carcinoma and metastatic cancer rapidly destroyed and resolved the radiopaque area of the MdPGC.
1. Polyacrylamide gel electrophoresis를 이용하여 국내외 재래종과 야생종 대두 계통들의 trypsin inhibitor의 변이를 규명하기 위하여 본 시험이 시도되었으며 1706계통의 한국산 재래종과 103계통의 한국 야생종콩, 그리고 167계통의 외래 재배종과 71계통의 외국 야생종 대두가 공시되었다. 2. Trypsin inhibitor를 함유하지 않은 ti/ti형과 Ti c/c형은 한국 재래종에서만 발견되었으며, Ti* c형을 Hymowitz도 일본 대두품종에서 보고한 바 있으나 그도 이 계통은 한국 도래종일 가능성이 크다고 보고 한 바 있다. 3. 한국기원의 콩에서 trypsin inhibitor에 관한 이형접합형의 출현빈도가 외국 기원 콩 계통에서 보다 비교적 높았으며, 재래종에서 3.6%(N=61)와 야생종에서 9.7%(N=10)이었으며 종합적으로 보아 중국, 일본 등의 대두에 비해 한국 기원의 콩이 가장 큰 변이를 나타내고 있음을 확인하였다.