To monitor sequential changes in diversity and abundance of moth community in forest, moth samples were weekly collected by light traps at nine survey sites from 2001 in Korea. Among these, samples collected at Osan from 2001 to 2006 and belonged to Notodontidae and Sphingidae (Lepidoptera) were selected for analysis. Diversity and equitability were estimated by Simpson's index. A total number of Notodontidae collected during the period were 47 species and 970 individuals. In case of Sphingidae, 27 species and 346 individuals were collected during the period. In 2001 and 2004, more than 10 species belonged to Notodontidae were collected from June to August whereas less than 10 species were collected from June to August in 2002, 2003, 2005 and 2006. In case of Sphingidae, more than 9 species were collected from June and August in 2001 and 2004 whereas less than 8 species were collected from June and August in 2002, 2003, 2005 and 2006. Interestingl y, total abundance of the two families had similar trends. The number of species was possibly related to the total abundance.
The first occurrence of oak wilt disease(OWD) in Korea was reported in 2004 and a Platypodid beetle, Platypus koryoensis, was known to contribute significantly the occurrence of the disease. To reduce the oak wilt disease, it is necessary to control density of P. koryoensis under injury level. This experiment conducted to clarify the flying period of adult P. koryoensis. Four forests containing dead trees by OWD were selected and the location of the experimental sites were Mt. Surak in Seoul, Goyang-si, Paju-si in Gyeonggi-do, Hongcheon-gun in Gangwon-do. Sticky trap or vertical multi-funnel trap was settled on Quercus mongolica trees located in infested forest. Density of P. koryoensis was survey with one or two week interval from May to October in 2007 and 2008. The number of the beetle collected by the vertical trap and sticky trap was positively correlated (r2=0.69). The optimum flying period of the beetle was ranged from late June to late July with geographical variations.
This study aims to explore the placement practices in five college English programs and four university language institutes. Specifically, the present study investigated the types of placement tests they administer, the degree of the correspondence between course objectives and test content, and validation procedures. This study also examined teachers" perceptions on the appropriateness of placement decisions. The data were collected through web site searches, semi-structured interviews and questionnaires. The results showed that proficiency tests were used for placement purposes in the college English programs. The language institutions administered placement tests only for their speaking courses in the form of oral interviews. The content of placement tests did not largely correspond with the course objectives. All English language programs did not have systematic procedures for identifying misplaced students. Finally, instructors reported that more than one third of the classes included misplaced students. The implications of the findings are discussed.
Al thou gh it was reported that the human genome had been entirely seq uenced. so far there frequently appeared non - redundant cDNAs in gene cloning of cellular mRNAs. Consequently a lot of effort is required to ide ntified the new genes for theil‘ localization in chromosome and their functlons If the new genes had small size sequences 0 1' were expressed in low level , 5' RACE became ha rd unexpectedly. Here. we demonstrated a new method of 5’ RACE by PCR cloning using hair pin prime r and cDNA template produced by gene specific primer. Firstly .. total RNA obtained from tissue 0 1' cells is primed for rever se transcri ption (Superscript lI) by antisense primer (AS-l) specilïc to the objective gen e in order to produce single strand cDNAs The cDNAs usua lly have 3' overhanging of CCC seq uence. SeconcUy, a hail‘ pin primer overhang GGG seq uence in 3' end (i .e ‘ Tn'AGTGAGGGTTA AGAAGGAGAATTAACCCTCACTAAAGGG) is rnixed with the cDNA produced above, and 1'01- lowed by heating at 70'C for 5 min and cooled in room temperature to make hairpin-end template cDNAs Thirdly, For PCR is performed using the ha irpin-end template cDNAs and primer set of inner hairpin sense primer (i . e., TAACCCTCACTA AAGGGG) and AS-1 using pfu polymerase. And next. the PCR product can be directly sequenced 0 1' subcloned into vector to seq uence the purified plasrnid DNA. In our laboratory several unidentified new genes have been under investigation for theil‘ genomic l oci and functions. However. one of them. a human short helical protein 1 (hSHP-1) was a short gene less than 600 bp in s ize. encoding 45 amino acids . hSHP-1 is able to produce a potent antimicrobial peptide which has similar strength to magainin from frogs. The hSHP-1 also showed multifunctional roles of innate imrnunity including not only the ant imicrobial activity against methi cillin resistant strains but a lso anti- neoplastic effect on precance rous cell s . Fluorescence in situ hybricli zation in chromosome was not successful due to weak signal. and genornic Southern of hSHP-l showecl a higher weak bancl. which is not clearly definecl as an comrnon genomic locus‘ but could be cons idered its or igin from centromere region which contains less frequent restri ction sites. And more, th e ordinary PCR cloning performed pre vious ly from human genornic DNA produced only repetitive non-specific DNAs which were not matched to hSHP-l cDNA This study demonstrated how we have don e the PCR cl oning usi ng ha irpin primer and cDNA template reve rsely transcribed by gene specific primer.
[n order to obtain the trlle expected DNA prod uct from PCR and RT-PCR using genornic DNA or cDNA reversely transcribed from mRNA. the PCR should be done in an appropriated condition. Sometimes the PCR was repeatedly fail ed. and cventllally the PCR product was turned out to be nonspecific and rudimentary . And more‘ t he PCR prodllctwas not reproducible even though careflll repeat of experiments. As the PCR was based on the exact primel hybridization. the condition of primer hybridization should be properly controlled by a nnealing temperatllre. But the selection of primer seqllences for targeting a specific gene is mostly important. A new method of primer eval uation is now available llsing DNA base pair polarity program. This study presents an example of PCR targeting to human Bax gene using genomic DNA. The DNA base pair polarity theory can di vide the genetic cord into propel DNA segments and calclllaLe their DNA base pair hybridization energy. Thus. mathematically the degree 0(' exact primer hybridization can be expected for the t r1l8 targeting of PCR. However, the DNA base pair polal'ityanalysis demonstrates that the more frequent number of DNA segment incl'eased the specificity of PCR. but decreased its sensitivity . While the greater polarity of DNA segment composed of increased nllmber of polarized DNA base pairs showed increased sensitivi ty 0 1' PCR. bllt relati vely decreased specificity of PCR. With the mllltiple analysis of PCR. especially for PCR cloning from the gDNA and cDNA, we found that the primers themselves showed secondary strllcture of partial hybridization between sameprimers or each pair primers. The DNA base pail‘ polarity signal can directly demonstrated symmetric sequences 0 1' each primer. and also can distinguish the dimmer formation from each pair primers. At least the symmetric seqllence of fOlll‘ base pairs dramatically showed the dimrner formation. On the other hand. in addi tion Lo the statlls of DNA base pair polarity the three-dimensional strllctllre of DNA dOllble helix targeted by the primer seqllences may affect the sensitivity and specificity of PCR detection. The present study introduced a new method of primer evalllation and selection in order to obtain abundant and exacL! y-trlle DNA product for genomic ffilltation analysis and gene expression profï le
Temperature signaling can be initiated by members of transient receptor potential (thermo-TRP) channels. Hot and cold substances applied to teeth usually elicit pain sensation. Since odontoblasts constitute a well-defined layer between the pulp and the mineralized dentin, being first to encounter thermal stimulation from oral cavity, they may be involved in sensory transduction process, in addition to their primary function as formation of dentin. We investigated whether thermo-TRP channels are expressed in a odontoblast cell line, MDPC-23. The expressions of thermo-TRP channels were examined using reverse transcription polymerase chain reaction (RT-PCR), immunohistochemistry, fluorometric calcium imaging. Analysis of RT-PCR revealed mRNA expression of TRPV1, TRPV2, TRPV4 and TRPM8, but no TRPV3, TRPA1. Immunohistochemical approach failed to detect TRPV1 expression. Whereas the application of 4-phorbol-12,13-didecanoate(10 μM, a TRPV4 agonist), menthol(1 mM, a TRPM8 agonist) and icilin(10 μM, a TRPM8 agonist) produced the enhancement of intracellular calcium concentration, capsaicin(1 μM, a TRPV1 agonist) did not. Our results suggest that subfamily of thermo-TRP channels expressed in odontoblasts may serve as thermal or mechanical transducer in teeth.
This study was undertaken to develop PCR primers for the identification and detection of Streptococcus anginosus using species-specific forward and reverse primers. These primers targeted the variable regions of the 16S ribosomal RNA coding gene(rDNA). The primer specificity was tested against 12 S. anginosus strains and 6 different species(10 strains) of oral bacteria. The primer sensitivity was determined by testing serial dilutions of the purified genomic DNA of S. anginosus ATCC 33397T. The data showed that species-specific amplicons were obtained from all the S. anginosus strains tested, but not in the six other species. The PCR could detect as little as 0.4pg of the chromosomal DNA from S. anginosus. This suggests that the PCR primers are highly sensitive and applicable to the detection and identification of S. anginosus.
Immuno-MemBlot is a technique for detecting, analyzing, and identifying proteins, similar to the Western blot technique but differing in that protein samples are not separated electrophoretically but are spotted through circular or slot templates directly onto the membrane. Recently we developed a new Immuno-MemBlot (IMB) method applying immunoreactions and coloring procedures directly in the wells of MemBlot apparatus, which were connected by canals to perform drainage for reagent application and buffer irrigation. This IMB method was designed to get theimmunoblot results more rapidly and clearly than the previous immunoblot ones. This study is aimed to evaluate the analytical accuracy of IMB using different biological assay. In the sensitivity test of IMB the monoclonal antibody can clearly detect the 30 ng (about 12 pM) of Mucocidin peptide (35 mer), and is also available to detect at least 10 ng (about 4 pM) of Mucocidin peptide (35 mer). The IMB was effective in the quantitative analysis of methothrexate (MTX) assay for cellular apoptosis. And more, this IMB is useful to screen large number of specific samples with ease and accuracy in a short time. In the screenings for the presence of Mucocidin in saliva the quantitative comparison is conspicuous among 48 persons depend on the different conditions ofgender, drinking and smoking habits, and oral diseases. Therefore, it is presumed that, even though the target proteins were partly degraded, a specific epitope can be detected if a monoclonal antibody was still reactive. Conclusively, these data suggest that the IMB can be useful in the primary qualitativeand quantitative analysis of proteins in various fluids, i.e., blood, saliva, tear, urine, etc.
Gene reg비 at i o n during the human craniofacial development is not well understood In effort to understand n ewly identifï ed genes that may play role(s) in the human craniofacial development, non-redundan t genes were isolated from the s ubtracted cDNA libra ry of human embryonal craniofacial tissues and examined their possible structu ral rolc in parallcl with thosc gcncs from isolatecl human c h o nclroc)πes cDNA library. Fifty genes were init ia ll y chosen from 398 clones iso latecl were used for selective dominant expression in both chondrocytes and the craniofacial sections of 10 weeks old human embryo by in situ hybridization method. Based upon the high levels 。f expression, we have identifi ecl seven unknown genes; ch89, ch96. ch129. ch 153. ch 276 ch285. and ch334 . In 。rder to unde rs tancl the possi ble role of these genes‘ the structural simulation of the expressed proteins were constructecl by Sybyl 6.6 program. Ch 276 gene was same with a clone, c14 0 1' f173. registered in GenBank(NM_022489) a nd is composed 0 1' 323 amino acids having a reverse s ignaling domain from the extra- cellular matrix(C-terminal) to cell membrane(N-terminal) and 12 turns of helical structure. Gene protein also r etains a famil iar fïbronectin binding domain(RGD). three s ites 0 1' Ca ion binding motifs. cAMP- and cGMP-dep endent protein kinase phos phorylation site, two regions of protein kinase C phosphorylation s ites. glyco- saminoglycan attachment s ite ancl N-glycosylation site. transmembrane and Al kaline Phosphatase active s ite domains This newly iclentifï ed human protein from human choncl rocytes cDNA library appearecl to be related to a known calcification s ignaling protein. was named as Ca lsin(Ch276) . Ch153 appeared to be related a family of anti-microbial peptide acting as an inflammation mediator and Ch334 clone as a zinc finger protein whose expression in creases in human adult ti ssue‘ These results suggest that these novel genes ident i!ï ed from human chondrocytes rnay provide a new path 0 1' embryonic cartilage development and human craniofacial development.
To evaluate parameters influencing on the dust removal of the High Temperature Filter(HTF) system, a computer simulation of fluid dynamics inside the system had been performed. The results showed that the optimum pulse jet periods were 50ms and 90ms for the 1000mm and 1500mm long filter elements respectively. Dust removal effect was very excellent under the pulse jet pressure of 3 bar. But the distance between the pulse jet nozzle and the venturi of a filter element had no meaningful effect on the performance with the variation from 5mm to 10mm. Compared to the dispersion mode of pulse jet, the collective mode of pulse jet flow was preferable in maintaining the pressure inside the system stable.
Human embryonic stem (ES) cells are derived from the inner cell mass of the preimplantation embryo. Human ES cells have the capacity to differentiate into various types of cells in the body. Human ES cells are indefinite source of cells for cell therapy in various degenerative disorders including neuronal disorders. Directed differentiation of human ES cells is a prerequisite for their clinical application. The objective of this study is to develop the culture condition for the derivation of neural precursor cells from human ES cells. Neural precursor cells were derived from human ES cells in a stepwise culture condition. Neural precursor cells in the form of neural rosette structures developed into neurospheres when cultured in suspension. Suspension culture of neurospheres has been maintained over 4 months. Expressions of nestin, soxl, sox2, pax3 and pax6 transcripts were upregulated during differentiation into neural precursor cells by RT-PCR analysis. In contrast, expression of oct4 was dramatically downregulated in neural precursor cells. Immunocytochemical analyses of neural precursor cells demonstrated expression of nestin and SOX1. When induced to differentiate on an adhesive substrate, neuro-spheres were able to differentiate into three lineages of neural systems, including neurons, astrocytes and oligo-dendrocytes. Transcripts of sox1 and pax6 were downregulated during differentiation of neural precursor cells into neurons. In contrast, expression of map2ab was elevated in the differentiated cells, relative to those in neural precursor cells. Neurons derived from neural precursor cells expressed NCAM, Tuj1, MAP2ab, NeuN and NF200 in immunocytochemical analyses. Presence of astrocytes was confirmed by expression of GFAP immuno-cytochemically. Oligodendrocytes were also observed by positive immuno-reactivities against oligodendrocyte marker O1. Results of this study demonstrate that a stepwise culture condition is developed for the derivation of neural precursor cells from human ES cells.