목 적: 본 연구는 한국인의 백내장과 녹내장의 유병률에 대해 알아 보고자 하였다. 방 법: 백내장과 녹내장의 유병률은 2007년도 국민건강영양조사 자료에서 30세 이상의 2,643명(남성: 1,101명, 여성: 1,543명)을 대상으로 하였다. 본 연구는 서베이분석법인 PROC SURVEYFREQ를 사용하여 사회경제적 위험요인과의 관계에 따른 유병률의 변화를 보았다. 모든 통계분석은 SAS 9.2 통계패키지를 사용하였으며, 유의성 검정은 0.05 이하로 하였다. 결 과: 2007년도 한국인은 3.0%(남성 9.8%, 여성 4.6%)가 백내장을 가지고 있었고, 7.8%(남성 5.7%, 여성 9.8%)가 백내장을 앓은 경험이 있었다. 녹내장 유병률과 경험률은 각각 0.2% (남성 0.4%, 여성 0.2%)와 0.5% (남성: 0.5%, 여성 0.4%)이었다. 65세 이상 남성 노인에서, 백내장 경험률 및 유병률은 19.9%와 4.1%이었으며, 여성에서는 38.3%와 17.2% 이었다. 그러나 30-64세 사이의 젊은 사람들에게 백내장 경험과 유병률이 남성에서 3.4%와 0.8%이었으며, 여성에서 1.6%와 3.0%이었다. 65세 이상 노인에서, 녹내장 경험률과 유병률은 남성에서 1.6%와 1.1%이었으며, 여성에서는 1.6%와 0.8%이었다. 젊은 사람들에게서 녹내장의 경험률과 유병률은 남성에서 0.3%와 0.1%이었으며, 여성에서는 모두 0.1% 이었다. 또한, 교육수준이나 소득이 낮은 경우, 비경제인구이거나 실업자의 경우 백내장과 녹내장의 유병률과 경험률이 높았다. 결 론: 30세 이상의 한국인에서 백내장의 유병률은 3.0%, 녹내장의 유병률은 0.2%였다. 본 연구결과는 한국인에서 안보건과 안질환의 적절한 건강관리 정책을 만드는데 있어 중요한 결과라고 할 수 있다.

Al thou gh it was reported that the human genome had been entirely seq uenced. so far there frequently appeared non - redundant cDNAs in gene cloning of cellular mRNAs. Consequently a lot of effort is required to ide ntified the new genes for theil‘ localization in chromosome and their functlons If the new genes had small size sequences 0 1' were expressed in low level , 5' RACE became ha rd unexpectedly. Here. we demonstrated a new method of 5’ RACE by PCR cloning using hair pin prime r and cDNA template produced by gene specific primer. Firstly .. total RNA obtained from tissue 0 1' cells is primed for rever se transcri ption (Superscript lI) by antisense primer (AS-l) specilïc to the objective gen e in order to produce single strand cDNAs The cDNAs usua lly have 3' overhanging of CCC seq uence. SeconcUy, a hail‘ pin primer overhang GGG seq uence in 3' end (i .e ‘ Tn'AGTGAGGGTTA AGAAGGAGAATTAACCCTCACTAAAGGG) is rnixed with the cDNA produced above, and 1'01- lowed by heating at 70'C for 5 min and cooled in room temperature to make hairpin-end template cDNAs Thirdly, For PCR is performed using the ha irpin-end template cDNAs and primer set of inner hairpin sense primer (i . e., TAACCCTCACTA AAGGGG) and AS-1 using pfu polymerase. And next. the PCR product can be directly sequenced 0 1' subcloned into vector to seq uence the purified plasrnid DNA. In our laboratory several unidentified new genes have been under investigation for theil‘ genomic l oci and functions. However. one of them. a human short helical protein 1 (hSHP-1) was a short gene less than 600 bp in s ize. encoding 45 amino acids . hSHP-1 is able to produce a potent antimicrobial peptide which has similar strength to magainin from frogs. The hSHP-1 also showed multifunctional roles of innate imrnunity including not only the ant imicrobial activity against methi cillin resistant strains but a lso anti- neoplastic effect on precance rous cell s . Fluorescence in situ hybricli zation in chromosome was not successful due to weak signal. and genornic Southern of hSHP-l showecl a higher weak bancl. which is not clearly definecl as an comrnon genomic locus‘ but could be cons idered its or igin from centromere region which contains less frequent restri ction sites. And more, th e ordinary PCR cloning performed pre vious ly from human genornic DNA produced only repetitive non-specific DNAs which were not matched to hSHP-l cDNA This study demonstrated how we have don e the PCR cl oning usi ng ha irpin primer and cDNA template reve rsely transcribed by gene specific primer.

[n order to obtain the trlle expected DNA prod uct from PCR and RT-PCR using genornic DNA or cDNA reversely transcribed from mRNA. the PCR should be done in an appropriated condition. Sometimes the PCR was repeatedly fail ed. and cventllally the PCR product was turned out to be nonspecific and rudimentary . And more‘ t he PCR prodllctwas not reproducible even though careflll repeat of experiments. As the PCR was based on the exact primel hybridization. the condition of primer hybridization should be properly controlled by a nnealing temperatllre. But the selection of primer seqllences for targeting a specific gene is mostly important. A new method of primer eval uation is now available llsing DNA base pair polarity program. This study presents an example of PCR targeting to human Bax gene using genomic DNA. The DNA base pair polarity theory can di vide the genetic cord into propel DNA segments and calclllaLe their DNA base pair hybridization energy. Thus. mathematically the degree 0(' exact primer hybridization can be expected for the t r1l8 targeting of PCR. However, the DNA base pair polal'ityanalysis demonstrates that the more frequent number of DNA segment incl'eased the specificity of PCR. but decreased its sensitivity . While the greater polarity of DNA segment composed of increased nllmber of polarized DNA base pairs showed increased sensitivi ty 0 1' PCR. bllt relati vely decreased specificity of PCR. With the mllltiple analysis of PCR. especially for PCR cloning from the gDNA and cDNA, we found that the primers themselves showed secondary strllcture of partial hybridization between sameprimers or each pair primers. The DNA base pail‘ polarity signal can directly demonstrated symmetric sequences 0 1' each primer. and also can distinguish the dimmer formation from each pair primers. At least the symmetric seqllence of fOlll‘ base pairs dramatically showed the dimrner formation. On the other hand. in addi tion Lo the statlls of DNA base pair polarity the three-dimensional strllctllre of DNA dOllble helix targeted by the primer seqllences may affect the sensitivity and specificity of PCR detection. The present study introduced a new method of primer evalllation and selection in order to obtain abundant and exacL! y-trlle DNA product for genomic ffilltation analysis and gene expression profï le

Immuno-MemBlot is a technique for detecting, analyzing, and identifying proteins, similar to the Western blot technique but differing in that protein samples are not separated electrophoretically but are spotted through circular or slot templates directly onto the membrane. Recently we developed a new Immuno-MemBlot (IMB) method applying immunoreactions and coloring procedures directly in the wells of MemBlot apparatus, which were connected by canals to perform drainage for reagent application and buffer irrigation. This IMB method was designed to get theimmunoblot results more rapidly and clearly than the previous immunoblot ones. This study is aimed to evaluate the analytical accuracy of IMB using different biological assay. In the sensitivity test of IMB the monoclonal antibody can clearly detect the 30 ng (about 12 pM) of Mucocidin peptide (35 mer), and is also available to detect at least 10 ng (about 4 pM) of Mucocidin peptide (35 mer). The IMB was effective in the quantitative analysis of methothrexate (MTX) assay for cellular apoptosis. And more, this IMB is useful to screen large number of specific samples with ease and accuracy in a short time. In the screenings for the presence of Mucocidin in saliva the quantitative comparison is conspicuous among 48 persons depend on the different conditions ofgender, drinking and smoking habits, and oral diseases. Therefore, it is presumed that, even though the target proteins were partly degraded, a specific epitope can be detected if a monoclonal antibody was still reactive. Conclusively, these data suggest that the IMB can be useful in the primary qualitativeand quantitative analysis of proteins in various fluids, i.e., blood, saliva, tear, urine, etc.

Gene reg비 at i o n during the human craniofacial development is not well understood In effort to understand n ewly identifï ed genes that may play role(s) in the human craniofacial development, non-redundan t genes were isolated from the s ubtracted cDNA libra ry of human embryonal craniofacial tissues and examined their possible structu ral rolc in parallcl with thosc gcncs from isolatecl human c h o nclroc)πes cDNA library. Fifty genes were init ia ll y chosen from 398 clones iso latecl were used for selective dominant expression in both chondrocytes and the craniofacial sections of 10 weeks old human embryo by in situ hybridization method. Based upon the high levels 。f expression, we have identifi ecl seven unknown genes; ch89, ch96. ch129. ch 153. ch 276 ch285. and ch334 . In 。rder to unde rs tancl the possi ble role of these genes‘ the structural simulation of the expressed proteins were constructecl by Sybyl 6.6 program. Ch 276 gene was same with a clone, c14 0 1' f173. registered in GenBank(NM_022489) a nd is composed 0 1' 323 amino acids having a reverse s ignaling domain from the extra- cellular matrix(C-terminal) to cell membrane(N-terminal) and 12 turns of helical structure. Gene protein also r etains a famil iar fïbronectin binding domain(RGD). three s ites 0 1' Ca ion binding motifs. cAMP- and cGMP-dep endent protein kinase phos phorylation site, two regions of protein kinase C phosphorylation s ites. glyco- saminoglycan attachment s ite ancl N-glycosylation site. transmembrane and Al kaline Phosphatase active s ite domains This newly iclentifï ed human protein from human choncl rocytes cDNA library appearecl to be related to a known calcification s ignaling protein. was named as Ca lsin(Ch276) . Ch153 appeared to be related a family of anti-microbial peptide acting as an inflammation mediator and Ch334 clone as a zinc finger protein whose expression in creases in human adult ti ssue‘ These results suggest that these novel genes ident i!ï ed from human chondrocytes rnay provide a new path 0 1' embryonic cartilage development and human craniofacial development.