This study was conducted to investigate the specific expression genes in the cloned bovine tissues. Donor cells, cloned tissues were analysed by RAPD-RFLP method. The results were detected three genes (CH-U7B, CH-U7M and CH-U7P) in the cloned fetus. It was found a single copy genes by southern hybridization. Sequence analysis of CH-U7M gene was shown 99% homology to a previously reported EST from a cloned bovine fetus. The putative ORF was encode a protein of hydrophobicity index 0.03. Semi-quantitative RT-PCR by using the CH-LS001 specific primer was remarkably detected in the lung tissue of cloned fetus. Further investigation of these genes may provide one of the key information to explain the early death, abnormal fetus, large off-spring and the low pregnancy rate in the production of cloned bovine.

Hemolin is a member of the immunoglobulin (Ig) superfamily and contains four Ig domainsthat are similar to neural cell adhesion molecules. It has been regarded as a recognition molecule at immune challenge in insects. This study showed that hemolin of Plutella xylostella was expressed during pupal and adult stages but absent in all larval instars without any immune challenge. It is, however, strongly induced by the injection of Escherichia coli or its lipopolysaccharide in hemocytes, fat body and gut. A double-stranded RNA (dsRNA) interference experiment revealedits role in activation of prophenoloxidase (PPO) in the hemolymph during bacterial infection. Also its involvement in cellular defense was investigated in its mediation of the adherence of hemocytes to rat blood erythrocytes which was knocked down by its dsRNA. Finally, its physiological significance in pupal stage was confirmed by using dsRNA, which significantly prevented adult development. Therefore, it is concluded that hemolin plays roles in both immune and adult development in P. xylostella.

Al thou gh it was reported that the human genome had been entirely seq uenced. so far there frequently appeared non - redundant cDNAs in gene cloning of cellular mRNAs. Consequently a lot of effort is required to ide ntified the new genes for theil‘ localization in chromosome and their functlons If the new genes had small size sequences 0 1' were expressed in low level , 5' RACE became ha rd unexpectedly. Here. we demonstrated a new method of 5’ RACE by PCR cloning using hair pin prime r and cDNA template produced by gene specific primer. Firstly .. total RNA obtained from tissue 0 1' cells is primed for rever se transcri ption (Superscript lI) by antisense primer (AS-l) specilïc to the objective gen e in order to produce single strand cDNAs The cDNAs usua lly have 3' overhanging of CCC seq uence. SeconcUy, a hail‘ pin primer overhang GGG seq uence in 3' end (i .e ‘ Tn'AGTGAGGGTTA AGAAGGAGAATTAACCCTCACTAAAGGG) is rnixed with the cDNA produced above, and 1'01- lowed by heating at 70'C for 5 min and cooled in room temperature to make hairpin-end template cDNAs Thirdly, For PCR is performed using the ha irpin-end template cDNAs and primer set of inner hairpin sense primer (i . e., TAACCCTCACTA AAGGGG) and AS-1 using pfu polymerase. And next. the PCR product can be directly sequenced 0 1' subcloned into vector to seq uence the purified plasrnid DNA. In our laboratory several unidentified new genes have been under investigation for theil‘ genomic l oci and functions. However. one of them. a human short helical protein 1 (hSHP-1) was a short gene less than 600 bp in s ize. encoding 45 amino acids . hSHP-1 is able to produce a potent antimicrobial peptide which has similar strength to magainin from frogs. The hSHP-1 also showed multifunctional roles of innate imrnunity including not only the ant imicrobial activity against methi cillin resistant strains but a lso anti- neoplastic effect on precance rous cell s . Fluorescence in situ hybricli zation in chromosome was not successful due to weak signal. and genornic Southern of hSHP-l showecl a higher weak bancl. which is not clearly definecl as an comrnon genomic locus‘ but could be cons idered its or igin from centromere region which contains less frequent restri ction sites. And more, th e ordinary PCR cloning performed pre vious ly from human genornic DNA produced only repetitive non-specific DNAs which were not matched to hSHP-l cDNA This study demonstrated how we have don e the PCR cl oning usi ng ha irpin primer and cDNA template reve rsely transcribed by gene specific primer.

Ionizing radiation is a well- known therapy factor for human carcinoma cells. Genotoxic stress mediates cell cycle control, transcription and cellular signaling. In this work, we have used a microarray hybridization approach to characterize the cell type-

Periodontalligament (PDL) fibroblasts have an ectomesenchymal origin and are known to participate not only in formation of PDL but also in the repair and regeneration of the a이acent alveolar bone and cementum. However, little is known about the molecular mechanism which is related to the development and differentiation of PDL cells. Recendy, we reported the PDLs (a periodontalligament-specific) 22 as a PDL fibroblast-specific mRNA which is not expressed in gingival fibroblasts. In this study, to examine the expression and functional characterization of PDμ22 mRNA and prαein in development and differentiation of periodontal 따sue ， we carried out northem analysis, insitu hybridization, immunofluorescence and immunohistochemistry. The expression of PDLs22 mRNA was increased with PDL cell differentiation from the confluent to multilayer stage but decreased slighdy with mineralized nodule formation in vitro. πle PDLs22 protein was localized on the nuclear membrane and expressed throughout the differentiation of PDL fibroblasts in vitro. The PDLs22 mRNA and protein were expressed in the differentiating cementoblasts, PDL fibroblasts and osteoblasts along the r∞t surface and alveolar bone of the developing rat teeth. These results indicate that the PDLs22 plays an irnportant role in the differentiation of cementoblasts and osteoblasts and thus homeostasis of cementum, PDL and alveolar bone.

한국산 멧누에(Bomdyx mandarina)chorion 유전자의 형질 발현기구를 규명하기 위한 연구의 일환으로 본 실험을 실시했다. 멧누에의 난각구조를 주사형 전자현마경에 의해 관찰한 결과 매우 특이적인 구조가 인정되었다. 즉 원추상의 불규칙 돌기에 의한 돌기구조층과 이 돌기 구조층을 덮고 있는 한 층의 얇은 덮개 구조층이 그것이다. 2차원 전기영동법에 의해 chorion 단백질을 분석한 결과, 난각을 구성하는 주요 단백질 성분은 등전점 4~6, 분자량 6~30 kd로 밝혀졌다. 특히 특이난각구조와 관련된 특이단백질 성분을 검출하였으며 이들의 대부분은 고cysteine 단백질인 것으로 추정했다. 이상의 연구결과에 의해 멧누에 난각의 특이 구조 형성에 따른 유전자발현기구 규명을 위한 기초자료가 얻어졌다.

Molecular markers, such as PCR-based and SNP-based markers, are extremely useful for plant genetics and crop breeding. Marker-assisted selection (MAS) has been widely applied in plant breeding to improve crop yield, quality, and tolerance to biotic and abiotic stresses. To develop gene-based (or -specific) molecular markers, three different approaches have been used in Brassica species: Known-gene-based, RNA seq/Exon-based and RNA seq/Intron-based molecular marker development for several years. Using these techniques, molecular markers have been developed to identify flowering time, anthocyanin accumuation and abiotic stresses in B. rapa and B. oleracea. Markers were distributed in exons as well as introns, and coding sequences and untranslated regions (UTRs). All markers developed have been transformed into SNP marker after HRM confirmation. I will discuss efficiency, accuracy, and potential problems and contribution of these markers for Brassica breeding.

Blackleg disease caused by Leptosphaeria maculans, is the most devastating disease of Brassica germplam worldwide that causes million tonnes of crop losses per year throughout the world. To date, a total of 12 race-specific resistance genes of Brassica napus to L. maculans have been reported but linkage mapping analysis reveals that all of those loci are located in A genome i.e., in B. rapa chromosomes. B. oleracea has high ancestral synteny with B. rapa through their evolution. We believe that presence of qualitative resistance is possible in B. oleracea germplasm. The present study was therefore planned to find out any race-specific qualitative resistance gene present in C genome of B. oleracea. A total of 16 microsatellite markers were used which are linked to seven different Rlm and Lep genes of B. napus to screen 32 inbred lines of cabbage. Primers were designed based on homology assessment in corresponding nucleotide sequence available in Bolbase (a B. oleracea genome database, http://www.ocri-genomics.org/bolbase/index.html), located in B. oleracea scaffolds/chromosomes. Out of 16 SSR markers, 13 were found polymorphic which indicates possible existence of resistant genes in cabbage lines. The inbred lines are then assessed against two L. maculans stains with known avirulent genes. Some inbred lines were hypersensitive against gene-specific virulent strains of L. maculans that confirmed existence of Rlm1, Rlm2, Rlm4, LepR3 and LepR4 in the cabbage lines. In this way we were able to select out resistant and susceptible lines against each resistant gene. The gene-specific polymorphic SSR marker regions were cloned and sequenced and candidate SNPs were identified for confirmation of their functionality.

Cambial meristematic cells (CMCs) are innately undifferentiated cells located in the meristems of plant with function as a stem cell to renew itself or replace specialized tissues. Another interesting feature of plant stem cells is controlling the plant defense in response to various stresses. Several groups have studied for stem cell triggered immunity signaling however, the molecular basis of the stem cell triggered immunity remains unclear. We previously obtained deferentially expressed 563 stem cell specific gene profiles from transcriptome analysis between two different cell types, CMC and dedifferentiated dells (DDCs) of yew tree (Taxuscuspidate). In a line of comparative genomics approach, we have selected 30 Arabidopsis homologous immune regulator candidate genes that showed significantly enriched GO terms ; at “response to stress” and “defense response”. We obtained one of homologous knock-out (KO) Arabidopsis mutant line on the locus At1G71110 whose cognate yew homologous gene showed predominantly expressed in CMCs compared to DDCs (20 times higher). For the assessment of basal disease resistance KO mutant plants were inoculated with Pseudomonas syringae pv. tomato (Pst) DC3000 and counted pathogen isolated from inoculated leaves. Interestingly, the KO mutant plants were not compromised in basal disease resistant, however, the hypersensitive response was significantly enhanced in the mutant compared to wild type in response to PstavrB, suggesting R-gene mediated defense response involved. We also investigated there sponse to the small reactive redox molecules such as reactive oxygen species (ROS) and reactive nitrogen species (RNS) that associated significantly in plant immune response. Notably the KO mutant plants exhibited hypersensitivity specifically under nitrosative stress condition derived by S-nitrosiglutathione (GSNO), anitrioxide (NO) donor. Taken all together, putative endomembrane components At1G71110 may play a pivotal role in R gene mediated plant immune system. To further investigate its role(s) and molecular signaling network various defense gene expression profiles and functional genomics approach are ongoing for the long term aim of muti-stress tolerant crop development

Rice is an important model species and one of the most staple crops of the world. The use of rice appropriate promoters suitable for a specific target transgene is important for the control of spatial and temporal transgene expression. To isolate rice tissue-specific promoters, we exploited the potential of whole genome microarrays in 17 stages: callus, germinating seed, leaf, root, the size of the panicles before heading (1, 3, 5, 8, 10, 15, 20, and 22 cm), and the number of days after pollination (1, 3, 5, 11, 21 DAP) using a 300 K Rice Genome Microarray, covering 31,439 genes of the rice. Eight candidate genes for tissue-specific expression were selected in various organs and stage of reproductive development in rice: Histone H4 for constitutive expression, Dehydrin DHN1 for callus-specific expression, germinating seed-specific hypothetical protein, root-specific hypothetical protein, DNA topoisomerase and Retinoblastoma for expression at panicles before heading, heading-specific profiling, and invertase for expression at seed after pollination. Promoter regions of the selected genes were isolated and fused to the β-glucoronidase (GUS) reporter gene, and the constructs were introduced into rice plants. These promoters are highly active in the tissue-specific manner of rice and can be useful for the spatial and temporal enhancement of target gene(s).

The use of functional markers, it is expected to make direct identification about genetic diversity at DNA level and overcome the problem of recombination /linkage. These markers can be used to identify interesting alleles in a breeding program and indirectly select for the trait, saving money, time and labor. Bacterial blight of rice caused by Xanthomonas oryzaepv. Oryzae is a destructive disease in rice production worldwide. No bactericide is effective to control the bacterial blight disease yet. Xa3, which is a gene conferring resistance to BB of the rice plant has been previously characterized by map-based cloning. We have cloned and sequenced the Xa3/xa3 gene in Korean cultivar, Hwayoung, Ilmi and Goun with gene specific primers. Our work detected polymorphisms and PCR-based allele specific SNP markers were developed. Susceptible or resistant individuals from an F2 population developed from across between Milyang244 and Ilmi, Korean germplasms and near isogenic lines carrying BB resistance genes were screened with allele specific markers. We found that the genotype completely matched their phenotype to BB using ASP-primers. These markers could be effective to marker-assisted selection for the Xa3 gene in rice breeding programs.

본 연구는 칡소와 한우 그리고 젖소의 각 군을 통하여 RAPD-PCR방법과 RFLP방법을 응용하여 칡소에서 특이적으로 발현되는 유전자의 검출과 발현빈도에 따른 표지유전자를 분석하여 칡소 특이적인 표지인자를 탐색하고자 실시하였다. 연구결과, RAPD분석을 통하여 칡소에서 특이적으로 표현되는 유전자들을 발견할 수 있었으며, 검출 유전자의 다양성이 모색과 종간의 차이가 있음을 알 수 있었다. 특이적으로 표현된 유전자들 중 칡소에서 특이적으로 표현되는 R9B

본 연구는 모로베레칸의 잎도열병 저항성유전자를 탐색하고, 이 저항성유전자와 연관된 분자표지를 탐색하기 위해 수행되었다. 도열병에 이병성인 일품벼와 도열병에 강한 모로베레칸을 교잡하여 육성된 140개 BC3F3 계통을 도열병 균계 반응을 통한 저항성 유전자 탐색에 이용하였다.