머루(Vitis coignetiae)는 국내에 자생하는 야생종 포도의 한 종류로서, 포도 새눈무늬병에 저항성이다. 내병성 포도 육종에 활용할 유용한 육종소재를 개발하고자 머루의 잎과 과실로부터 cDNA libraray를 제작하였다. 머루의 cDNA library의 총 5,760개의 EST 클론을 분석하여 676개의 contig와 2,306개의 singleton을 분리하여 총 2,982개의 unigene을 분리하였다.
NCBI 데이터베이스의 BLAST를 통한 상동성을 검색한 결과, 2,241개의 클론이 기능이 알려진 유전자이었고, 그 중에서 1,442개는 생물학적인 대사에 관여하고 836개는 세포구성물과 관련이 있었다.
EST와 contig의 평균 크기는 각각 702bp와 757bp이었다. 포도새눈무늬병균에 감염된 머루 cDNA library로부터 Proline-rich cell wall protein, thaumatin-like protein, class IV chitinase, and pathogenesis-related (PR) protein 10 등의 다양한 방어관련 유전자와 광합성관련유전자 및 수분스트레스 저항성 관련유전자가 많이 검출되었다. 본 연구를 통해 얻어진 머루의 EST 자료는 포도의 새로운 유전자원에 관한 연구 및 내병성 포도 신품종 육종 프로그램에 기본자료로 유용하게 활용될 것이다.
Diapause duration of Paratlanticus ussuriensis is prolonged as an egg that enter both initial and final diapause stgaes. Environmental conditions, such as temperature, can modify the duration of initial diapause. Eggs enter initial diapause at 20℃, but continued early embryonic development at 30℃. Final diapause at a fully developed embryonic stage is obligatory regardless of temperature conditions. To determine temperature effects on initial diapause mechanism of P. ussuriensis eggs, we compared weights, DNA and RNA amounts of eggs incubated at either 20℃ or 30℃ for 50 days after oviposition. We identified small heat shock protein (shsp), heat shock protein 90 (hsp90) and three heat shock protein 70 (hsp70a, hap70b, hsp70c) genes of P. ussuriensis and determined those expression levels at different temperature conditions. The levels of shsp, hsp70a, hsp70b and hsp90 was not detectable until 20 days after oviposition at both temperature conditions, but highly increased at 50 and 60 days when incubated at 30℃. In contrast, hsp70c level was rapidly peaked at 20 days after oviposition, which is the time of initial diapause entrance. We analysis of temperature sensitivity of P. ussuriensis eggs. Hsp70a is expressed after the first cold treatment of mature eggs. Hsp70b is highly expressed just before hatching. Both shsp and hsp70c was highly expressed at the heat shock condition into immature egg stage. Our results suggest that high temperature breakdown initial diapause and one hsp gene, such as hsp70c, may be involved into the mechanism of initial diapause of P. ussuriensis eggs.
Fungi belonging to the Paecilomyces spp. have recently been used as food and herbal medicines in Korea and are greatly popular as commercially available powdered supplement or dried fruiting body. Despite this acceptance and its use, little is known of the genes related to its reactive agents. Presently, We have constructed an olig-d(T) primed directional cDNA library from the silkworm Dongchunghacho, an entomopathogenic fungus, of which species is belonging to Paecilomyces spp. based on the previous identification of ITS1 and ITS2 at the molecular level and collected from Jocheon Miryang, Korea. To isolate and screen genes in the fungus, 626 expressed sequence tags(ESTs) were generated by a partial sequencing from the cDNA library. cDNA encoding the glyceraldehyde-3-phosphate dehydrogenase(Pt-GAPDH) of Paecilomyces tenuipes- Jocheon was cloned from the above cDNA library. The complete cDNA sequence of Pt-GAPDH is comprised of 1,014bp encoding 338 amino acid residues. The deduced protein sequence of Pt-GAPDH showed higher homology with Beauberia bassiana-GAPDH(93% amino acid identity). Hydropathy analysis revealed that Pt-GAPDH protein is hydrophilic. The major three amino acids in its composition of amino acid residues were alanine(11.54%), valine(9.47%) and glycine(8.88%). The Pt-GAPDH gene of Paecilomyces tenuipes entomopathogenic fungus consisted of three exons and two introns coding for 338 amino acid residues, and the genomic DNA length of the gene spans 1302bp. The accession number of the gene in GenBank are GU997099 for Pt-GAPDH cDNA and GU997102 for Pt-GAPDH genomic DNA. More investigation works including gene expression, immunological analysis etc. will be carried continuously without hesitation after this presentation.
This study aimed at investigating the gene expression profile in basal ganglia of hexa-valence chromium exposed rat based on cDNA array analysis. For cDNA array, Sprague-Dawley male rats (300 ± 25 g) were administrated with 15 mg/kg B.W/day of potassium dichromate by gavage (0.3 ml) dissolved in saline for 10 days (n=5). For dose-related gene expression analysis, rats were administrated with 0, 1, 5 mg/kg B.W/day of potassium dichromate for 10 days. Control rats were administrated with equal volume of saline (n=5). For cDNA array analysis, RNA samples were extracted from brain tissue and reverse-transcribed in the presence of [α32P]-dATP. Membrane sets of the Atlas array II and Toxicology array kits were hybridized with cDNA probe sets. RT-PCR and Northern blot hybridization methods were employed for validation and assessment of the dose-related gene expression profile, respectively. Among the 2352 cDNAs, 43 genes showed significant (>two-fold) changes in expression. 22 genes were up-regulated and 21 genes were down-regulated in the 15 mg/kg B.W/day hexa-valence chromium treated group than control. According to the Northern blot hybridization analysis, heat shock protein 47, neurodegeneration associated protein 1 and pituitary specific growth factor 1a genes were up-regulated, but Gamma-aminobutyl-acid a1 subunit, neuroligin2, brain calcium-transporting plasma membrane type ATPase genes were down-regulated even in the low-dose of hexa-valence chromium exposed group (1 mg/kg B.W/day) than control. Genes that detected in this study may be closely related to the hexa-valence chromium-induced neurotoxicity in the rat basal ganglia and addition study of these genes can give some more useful information about the neuro-toxic mechanism by hexa-valence chromium.
Nuclear factor I-C (NFI-C) null mice demonstrated aberrant odontoblast differentiation, abnormal dentin formation, and thus molar lacking roots. However, the mechanism by which the disruption of NFI-C gene affect the expression of other genes in dental pulp cells remains unknown. In this study, in order to understand this mechanism, the gene expression of pulp cells in NFI-C deficient mice were compared to those of wild-type mice by cDNA microarray analysis. According to the cDNA microarray profile comparison, the disruption of NFI-C gene increased the expression of TGF-β and TGF-β receptor, whereas it decreased the expression of Smad proteins. Interestingly, most of the FGF-related genes were down-regulated in pulp cells by NFI-C gene disruption. Among the cell cycle-related genes, the expression of p16 and p18 were increased by NFI-C disruption, but the expression of cy clin E1 and cy clin D1 were decreased by NFI-C disruption. These results indicate that the disturbance of NFI-C gene suppressed the proliferation of pulp cells and up-regulated the expression of TGF-β and its downstream signaling molecules during root formation, contributing to the formation of short root containing abnormal dentin.
A thioredoxin peroxidase (TPx) gene was cloned from the bumblebee, Bumbus ignitus. The B. ignitus TPx (BiTPx) contains an open reading frame of 585 bp encoding 195 amino acid residues and possesses two cysteine residues that are characteristic of 2-Cys subgroup of peroxiredoxin family. The deduced amino acid sequence of the BiTPx cDNA showed 90% identity to Apis melifera (AmTPx-1), 80% to Aedes aegypti (AaTPx), and 78% - 47% to other insect 2-Cys TPx. Northern blot analysis revealed the presence of BiTPx transcripts in all tissues examined. Western blot analysis showed the presence of the BiTPx in the fat body, midgut, muscle and epidermis, but not in the hemolymph, suggesting the BiTPx is not secretable. The cDNA encoding BiTPx was expressed as a 27-kDa polypeptide in baculovirus-infected insect Sf9 cells. The purified recombinant BiTPx was shown to reduce H2O2 in the presence of electrons donated by dithiothreitol and shown to be active in the presence of thioredoxin as electron donor.
Al thou gh it was reported that the human genome had been entirely seq uenced. so far there frequently appeared non - redundant cDNAs in gene cloning of cellular mRNAs. Consequently a lot of effort is required to ide ntified the new genes for theil‘ localization in chromosome and their functlons If the new genes had small size sequences 0 1' were expressed in low level , 5' RACE became ha rd unexpectedly. Here. we demonstrated a new method of 5’ RACE by PCR cloning using hair pin prime r and cDNA template produced by gene specific primer. Firstly .. total RNA obtained from tissue 0 1' cells is primed for rever se transcri ption (Superscript lI) by antisense primer (AS-l) specilïc to the objective gen e in order to produce single strand cDNAs The cDNAs usua lly have 3' overhanging of CCC seq uence. SeconcUy, a hail‘ pin primer overhang GGG seq uence in 3' end (i .e ‘ Tn'AGTGAGGGTTA AGAAGGAGAATTAACCCTCACTAAAGGG) is rnixed with the cDNA produced above, and 1'01- lowed by heating at 70'C for 5 min and cooled in room temperature to make hairpin-end template cDNAs Thirdly, For PCR is performed using the ha irpin-end template cDNAs and primer set of inner hairpin sense primer (i . e., TAACCCTCACTA AAGGGG) and AS-1 using pfu polymerase. And next. the PCR product can be directly sequenced 0 1' subcloned into vector to seq uence the purified plasrnid DNA. In our laboratory several unidentified new genes have been under investigation for theil‘ genomic l oci and functions. However. one of them. a human short helical protein 1 (hSHP-1) was a short gene less than 600 bp in s ize. encoding 45 amino acids . hSHP-1 is able to produce a potent antimicrobial peptide which has similar strength to magainin from frogs. The hSHP-1 also showed multifunctional roles of innate imrnunity including not only the ant imicrobial activity against methi cillin resistant strains but a lso anti- neoplastic effect on precance rous cell s . Fluorescence in situ hybricli zation in chromosome was not successful due to weak signal. and genornic Southern of hSHP-l showecl a higher weak bancl. which is not clearly definecl as an comrnon genomic locus‘ but could be cons idered its or igin from centromere region which contains less frequent restri ction sites. And more, th e ordinary PCR cloning performed pre vious ly from human genornic DNA produced only repetitive non-specific DNAs which were not matched to hSHP-l cDNA This study demonstrated how we have don e the PCR cl oning usi ng ha irpin primer and cDNA template reve rsely transcribed by gene specific primer.
Studies to evaluate distribution of markers in normal keratinocyte and their immortalized keratinocyte are appropriate to evaluate the normal and preneoplastic lesion of oral cancers as biochemical and cytochemical changes associate with tumorigenesis being not completely understood. Complementary DNA microarray containing 6000 sequence -verified cDNA elements was used to systematically characterize the variation in gene expression patterns of NHOK cells vs. immortalized keratinocyte by HPV16 E6-E7(IHOK). Examination of gene expression that is 85 clones cDNAs exhibits greater than 2 fold overexpression in NHOK probes relative to IHOK probe, 147 cDNAs reveal greater 2 fold overexpression in IHOK relative to NHOK probe.The high similarity in gene expression (96.5%) between IHOK and NHOK cells suggests that only an additional 232/6720 (3.5%) of the genome is differentially gene activated during HPV16 immoratlized keratinocyte growth and differentiation. Examination of gene expression that differs between NHOK and IHOK cellsapprear to be related to : cell adhesion & recognition, cell cycle regulator, apoptosis, transciption factors, growth factors and therir receptors, cytoskeletal and extracellular matrix proteins, signal transduction modulators and effectors, and miscellaneous. The gene expression of cell recognition factor such as endothelin 1, collagen IV, fibronectin, and SPR1 in IHOK were upregulated. Distinct or duplicated cDNA clones representing the same gene were typically clustered in adjacent rows in the clustered gene map. Therefore the differentially expressed and identified genes should be informative in studying oral epithelial cell carcinogenesis and such studies should foster the research of molecular markers allowing to assess the phenotypeof malignant epithelial tumor.