메타바코딩을 이용한 환경 DNA 분석은 검출 감도가 높아 어류의 생물다양성 평가 및 멸종위기종의 검출에 유용 한 기술이다. 이번 연구는 메타바코딩을 이용해 우리나라 담수어류를 대상으로 높은 검출 효율을 보일 수 있는 적합 한 분석방법을 확인하기 위해 4가지 분석조건별, 즉 필터 (cellulose nitrate filter, glass fiber filter), 추출 키트 (DNeasy® Blood & Tissue Kit, DNeasy® PowerWater Kit), 프라이머 조합 (12S rDNA, 16S rDNA) 그리고 PCR 방법 (conventional PCR, touchdown PCR)로 나타나는 Operational Taxonomic Units (OTUs) 수와 종 조성을 비교하였다. Glass fiber filter와 DNeasy® Tissue & Blood Kit를 이용해 추출한 시료는 12S rDNA와 16S rDNA 프라이머 조합에서 담수어류 OTUs가 가장 많이 검출되었다. 모든 분석조건 중 프라이머 조합에서만 조기어강 (Class Actinopterygii) 평균 OTUs 수에서 통계적으로 유의한 차이를 보였고 (Non-parametric Wilcoxon Signed Ranks Test, p=0.005), 담수어류 평균 OTUs 수는 유의하지 않았다. 종 조성 비교 결과 역시 프라이머 조합에서 유의한 차이를 보였고 (PERMANOVA, Pseudo-F=6.9489, p=0.006), 나머지 분석조건에서는 유의한 차이를 보이지 않았다. NMDS 분석 결과 종 조성은 유사도 65% 기준에서 프라이머 조합에 따라 묶였고, 16S rDNA 프라이머 세트는 주로 멸종위기종인 모래주사 (Microphysogobio koreensis), 꼬치동자개 (Pseudogobio brevicorpus)가 기여하였고, 12S rDNA 프라이머 세트는 주로 일반종인 피라미 (Zacco platypus), 꺽지 (Coreoperca herzi) 등이 기여한 것으로 나타났다. 본 연구는 국내 하천에서 채취한 시료에 대한 메타바코딩을 이용한 종 다양성 분석의 기초정보를 제공한다.

본 연구는 S. aureus을 신속하게 검출할 수 있는 PCR primer를 개발하고자 실시되었다. S. aureus를 포함한 Clostridium, Escherichia, Salmonella, Shigella, Vibrio, Bifidobacteria, Lactobacillus, Streptococcus 등 그람 양성 및 그람 음성 균주 17 종의 genomic DNA를 대상으로 20종의 랜덤 primer들을 사용하여 PCR을 실시하였다. S. aureus의 특이적 밴드를 선발하여 DNA 염기 서열을 분석하였고 이를 바탕으로 5쌍의 primer를 제작하였으며 그 중 primer SYU-5를 사용하여 PCR을 실시할 경우, 단일 밴드로 나타나는 다른 균주들에 비해 S. aureus 균주에서 약 250, 550 및 850 bp 크기의 세 개 밴드들이 검출되었다. 또한, S. aureus가 첨가된 8종 균주들의 genomic DNA 혼합 용액과 각종 유제품 및 분쇄육을 대상으로 primer SYU-5의 특이적 검출능을 확인하였다. 본 연구에서 사용한 PCR 기법은 기존의 선택배지 배양법과 비교하여 시간 및 노동력 측면에서 식중독 유발 S. aureus의 검출에 보다 효과적인 방법으로 사용 가능하였다. 또한, 본 연구의 결과는 다양한 병원균들의 특이적 검출을 위한 PCR 기법 개발에 기초 자료를 제공할 수 있다.

In order to determine an authenticity of food ingredient, we used DNA barcode method by universal primers. For identification of animal food ingredients, LCO1490/HCO2198 and VF2/FISH R2 designed for amplifying cytochrome c oxidase subunit1 (CO1) region and L14724/H15915 for cytochrome b (cyt b) region on mitochondrial DNA were used. Livestock (cow, pig, goat, sheep, a horse and deer) was amplified by LCO1490/HCO 2198, VF2/FISH R2 and L14724/H15915 primers. Poultry (chicken, duck, turkey and ostrich) was amplified by LCO1490/HCO 2198 and VF2/FISH R2 primers. But, Fishes (walleye pollack, herring, codfish, blue codfish, trout, tuna and rockfish) were only amplified by VF2/FISH R2 primers. For plant food ingredients, 3 types of primers (trnH/ psbA, rpoB 1F/4R and rbcL 1F/724R) have been used an intergenic spacer, a RNA polymerase beta subunit and a ribulose bisphosphate carboxylase region on plastid, respectively. Garlic, onion, radish, green tea and spinach were amplified by trnH/psbA, rpoB 1F/4R and rbcL 1F/724R. The PCR product sizes were same by rpoB 1F/4R and rbcL 1F/724R but, the PCR product size using trnH/psbA primer was different with others for plants each. We established PCR condition and universal primer selection for 17 item's raw materials for foods and determine base sequences aim to PCR products in this study. This study can apply to determine an authenticity of foods through making an comparison between databases and base sequences in gene bank. Therefore, DNA barcode method using universal primers can be a useful for species identification techniques not only raw materials but also processed foods that are difficult to analyze by chemical analysis.

In this study, a method was developed using molecular biological technique to distinguish an authenticity of meats for processed meat products. The genes for distinction of species about meats targeted at 12S or 16S genes in mitochondrial DNA and the species-specific primers were designed by that PCR products' size was around 200bp for applying to processed products. The target materials were 10 species of livestock products and it checked whether expected PCR products were created or not by electrophoresis after PCR using species-specific primers. The results of PCR for beef, pork, goat meat, mutton, venison, and horse meat were 131, 138, 168, 144, 191, and 142 bp each. The expected PCR products were confirmed at 281, 186, 174, and 238 bp for chicken, duck, turkeymeat, and ostrich. Also, non-specific PCR products were not detected in similar species by species-specific primers. The method using primers developed in this study confirm to be applicable for composite seasoning including beefs and processed meat products including pork and chicken. Therefore, this method may apply to distinguish an authenticity of meats for various processed products.

We have previously shown that the larvae of swallowtail butterfly, Papilio xuthus, exhibit substantial antibacterial activity in the hemolymph, upon challenging with bacterial lipopolysaccharide (LPS). Here we report the isolation and molecular characterization of several immune inducible genes that are specifically expressed by employing annealing control primer (ACP)-based GeneFishing polymerase chain reaction (PCR) from P. xuthus the larva. Using 120 arbitrary ACPs, we identified 24 differentially expressed genes (DEGs) that are up-regulated in response to injected LPS. Sequence analysis showed that 18 DEGs revelaed a high sequence similarity to the previously characterized genes of other insects, although 6 DEGs showed no significant similarity to any known genes. Among these inducible transcripts we found 8 putative immune-related genes including cecropin and attacin. Finally, we analysed the expression profiles of potential immune-related genes by RT-PCR and found all of them were considerably increased in the mRNA levels by LPS injection.

Al thou gh it was reported that the human genome had been entirely seq uenced. so far there frequently appeared non - redundant cDNAs in gene cloning of cellular mRNAs. Consequently a lot of effort is required to ide ntified the new genes for theil‘ localization in chromosome and their functlons If the new genes had small size sequences 0 1' were expressed in low level , 5' RACE became ha rd unexpectedly. Here. we demonstrated a new method of 5’ RACE by PCR cloning using hair pin prime r and cDNA template produced by gene specific primer. Firstly .. total RNA obtained from tissue 0 1' cells is primed for rever se transcri ption (Superscript lI) by antisense primer (AS-l) specilïc to the objective gen e in order to produce single strand cDNAs The cDNAs usua lly have 3' overhanging of CCC seq uence. SeconcUy, a hail‘ pin primer overhang GGG seq uence in 3' end (i .e ‘ Tn'AGTGAGGGTTA AGAAGGAGAATTAACCCTCACTAAAGGG) is rnixed with the cDNA produced above, and 1'01- lowed by heating at 70'C for 5 min and cooled in room temperature to make hairpin-end template cDNAs Thirdly, For PCR is performed using the ha irpin-end template cDNAs and primer set of inner hairpin sense primer (i . e., TAACCCTCACTA AAGGGG) and AS-1 using pfu polymerase. And next. the PCR product can be directly sequenced 0 1' subcloned into vector to seq uence the purified plasrnid DNA. In our laboratory several unidentified new genes have been under investigation for theil‘ genomic l oci and functions. However. one of them. a human short helical protein 1 (hSHP-1) was a short gene less than 600 bp in s ize. encoding 45 amino acids . hSHP-1 is able to produce a potent antimicrobial peptide which has similar strength to magainin from frogs. The hSHP-1 also showed multifunctional roles of innate imrnunity including not only the ant imicrobial activity against methi cillin resistant strains but a lso anti- neoplastic effect on precance rous cell s . Fluorescence in situ hybricli zation in chromosome was not successful due to weak signal. and genornic Southern of hSHP-l showecl a higher weak bancl. which is not clearly definecl as an comrnon genomic locus‘ but could be cons idered its or igin from centromere region which contains less frequent restri ction sites. And more, th e ordinary PCR cloning performed pre vious ly from human genornic DNA produced only repetitive non-specific DNAs which were not matched to hSHP-l cDNA This study demonstrated how we have don e the PCR cl oning usi ng ha irpin primer and cDNA template reve rsely transcribed by gene specific primer.

[n order to obtain the trlle expected DNA prod uct from PCR and RT-PCR using genornic DNA or cDNA reversely transcribed from mRNA. the PCR should be done in an appropriated condition. Sometimes the PCR was repeatedly fail ed. and cventllally the PCR product was turned out to be nonspecific and rudimentary . And more‘ t he PCR prodllctwas not reproducible even though careflll repeat of experiments. As the PCR was based on the exact primel hybridization. the condition of primer hybridization should be properly controlled by a nnealing temperatllre. But the selection of primer seqllences for targeting a specific gene is mostly important. A new method of primer eval uation is now available llsing DNA base pair polarity program. This study presents an example of PCR targeting to human Bax gene using genomic DNA. The DNA base pair polarity theory can di vide the genetic cord into propel DNA segments and calclllaLe their DNA base pair hybridization energy. Thus. mathematically the degree 0(' exact primer hybridization can be expected for the t r1l8 targeting of PCR. However, the DNA base pair polal'ityanalysis demonstrates that the more frequent number of DNA segment incl'eased the specificity of PCR. but decreased its sensitivity . While the greater polarity of DNA segment composed of increased nllmber of polarized DNA base pairs showed increased sensitivi ty 0 1' PCR. bllt relati vely decreased specificity of PCR. With the mllltiple analysis of PCR. especially for PCR cloning from the gDNA and cDNA, we found that the primers themselves showed secondary strllcture of partial hybridization between sameprimers or each pair primers. The DNA base pail‘ polarity signal can directly demonstrated symmetric sequences 0 1' each primer. and also can distinguish the dimmer formation from each pair primers. At least the symmetric seqllence of fOlll‘ base pairs dramatically showed the dimrner formation. On the other hand. in addi tion Lo the statlls of DNA base pair polarity the three-dimensional strllctllre of DNA dOllble helix targeted by the primer seqllences may affect the sensitivity and specificity of PCR detection. The present study introduced a new method of primer evalllation and selection in order to obtain abundant and exacL! y-trlle DNA product for genomic ffilltation analysis and gene expression profï le

RAPD-PCR(Random Amplified Polymorphic DNAs-Polymerase Chain Reation) 기법에 누에의 유전적 변이 분석을 위한 첫 단계로 다양한 GC함량을 갖는 random primer에 의해서 증폭되는 DNA 단편의 양상 및 증폭도를 비교하였다. RAPD-PCR을 위한 random primer의 증폭도는 GC함량에 의해서 상당히 영향을 받음이 분석되었다. 특히, 50% GC 함량을 갖는 primer는 그 증폭도에 따라서 4가지의 그룹으로 DNA단편이 증폭되었으며 〔bad amplification (75.5%), poor amplification (11.1%), good and excellent amplification(11.1%)〕, primer의 GC 함량이 증가할수록, 휠씬 더 좋은 증폭도를 보여주었다. 그러나, 40% GC 함량을 갖는 primer에 의해서는 어떤 증폭산물도 관찰되지 않았다. PCR을 수행하기 전에 6가지의 제한효소(BamHI, HindIII, Xbal, HaeIII, MspI, Rsal)를 사용하여 누에 genomic DNA를 처리하여 이를 주형 DNA로 하여 RAPD-PCR을 수행한 결과, 유전적 마커의 생산에 대한 효율이 증가함을 알 수 있었다. 이상의 결과를 종합해 볼 때 60%이상의 GC함량을 갖는 random primer와 전처리한 주형 DNA의 사용은 여러 가지 다른 누에 계통의 동정 및 연관군 지도작성에 따른 경비 및 시간을 줄이는데 효율적이라고 사료된다.

The object of this study was to use genomic information obtained from wheat-rice sequence to develop genome-specific PCR primer for Agp-L gene involved in starch biosynthesis. Intron locations in wheat were inferred through alignment of wheat cDNA sequence of Agp-L with rice genomic sequence. Exon-anchored primer which amplify across introns allowed sequencing of introns from the three genomes provided the basis for genome-specific primer design. The single nucleotide polymorphism (SNP) was identified and this SNP could be converted into cleaved amplified polymorphism sequence (CAPS).