James S. Gale (1863-1937), a Protestant missionary to Korea (1888~1927), was well-known for his extensive and profound influence on Korean studies and for his translation of the Cloud Dream of Nine (九雲夢), which was the first Korean classical novel translated into English by a Westerner. However, it is not well-known that Gale published a translation of the Great Learning (Daxue, 1924) and arranged for the publication of the Mean of the Doctrine, the Analects and Mencius. This is because it was known that Gale regarded Chinese characters and Confucian scriptures as obstacles to establishing the Christianity during his early period of mission in Korea. This paper examined the change of Gale’s perspective of Chinese characters and the characteristics of Gale’s Daxue. The analysis compares Gale and James Legg in their translations of the Chinese characters ‘命,’ ‘天,’ ‘明’ and ‘君子’ He employed the pure Korean word ‘Hananim’ for ‘God’ from a traditional Korean religion and its Korean etymology, while he rejected the use of Sino-Korean ‘Sangje上帝’, or ‘Chunju天主’ in the Korean Bible. Gale subsequently translated Daxue from a Korean point of view. However, his Korean perspective is mingled with Christianized concepts, which are illustrated in his translation of ‘命’ as ‘God’s command’ ‘天’ as ‘God’ ‘明’ as ‘glory,’ and ‘君子’ as ‘good man’ and ‘godly man.’

본 연구에서 Periphyllus acerihabitans를 국내에서 최초로 보고한다. 이 종의 분포지역, 기주식물, 무시성충의 형태학적 정보와 분류키를 제공 하였다.

The black cutworm, Agrotis ipsilon (Hufnagel, 1766) is a cosmopolitan pest that poses an economic threat to many crops such as pepper, corn, perilla, etc. A. ipsilon can be mass reared by providing Chinese cabbage, Brassica rapa under 60~70%, 16L:8D and 25±1℃ in laboratory. This study presents the mass rearing methods and the morphological characteristics of the immature stages of A. ipsilon including descriptions of the each immature stages.

The turnip sawfly, Athalia rosae is one of the main pests that damage the leaves of cabbage, radish and other cruciferous crops. The developmental biology and morphological characteristics of the immature stages of Athalia rosae were studied in the laboratory using host plant, Chinese cabbage, Brassica rapa var. glabra. A. rosae can be mass reared in laboratory throughout the year under RH 60~70%, 16L:8D and 25±1℃. This species has six larval stages in the female and five larval stages in the male. The developmental period is about 28~29 days. Ovipositional periods and larval developmental periods were 6, 9 days, respectively. The pupal period was about 14 days. Illustrations and descriptions of the various immature stages and their behaviors are provided.

Aneurysmal bone cyst (ABC) in maxilla is a rare and benign lesion but shows extensive bony destruction, occasionally accompanied with secondary osseous lesions, i.e., central giant cell granuloma, ossifying fibroma, fibrous dysplasia, etc. As the pathogenesis of ABC has not been clearly defined, ABC is diagnostically challenged due to its variable histological features. A 17-year-old boy showed a huge radiolucent lesion at right anterior maxilla, which was accidentally found in routine dental-radiological examination for orthodontic treatment. He had no medical history of systemic disease, and did not remember any traumatic experience on his right anterior maxilla. The radiolucent lesion involved periapical area from right central incisor to right first premolar, and was clinically diagnosed as odontogenic keratocyst. During surgical operation a cyst-like sac was enucleated with severe hemorrhage. In the histological observation the thick fibrous sac showed no lining epithelium, and its luminal side disclosed multiple aneurysmal spaces which were shrunken and almost obliterated. The fibrous sac itself was hyperplastic with abundant vascular channels, and produced fibromatous thickening associated with ossifying trabecular bones. This fibro-osseous tissue was hamartomatous, which was not directly connected and organized with marrow bone of maxilla. Finally, the present case was diagnosed as secondary type ABC differentially from traumatic bone cyst (TBC), odontogenic cyst, and central reparative granuloma. And it was presumed that the hamartomatous proliferation of fibro-osseous tissue in the cystic sac of ABC could produce the swelling pressure effect in the bone marrow similar to the overgrowth of central giant cell granuloma, ossifying fibroma, fibrous dysplasia, etc., in the secondary type ABC.

농산물 중 hexaconazole 분석을 위해, GC-NPD를 이용하여 다종농약 다성분 분석법을 적용하고자 본 연구를 수행하였다. Hexaconazole의 다종농약 다성분 분석법 유효성 검증은 직선성, 정확성, 정밀성, 검출한계 및 정량한계로 하였다. 0.025~5.0 mg/L의 농도에서 검량선의 상관계수(R2)는 0.999이상의 우수한 직선성을 보였다. 상추에 0.04~4.0 mg/kg을 첨가한 농약의 회수율은 89.42~94.15%였고, RSD는 7.78%이하의 재현성을 나타냈다. 검출한계는 0.04mg/kg였고, 정량한계는 0.11 mg/kg였다. 일간 및 일내 정밀도는 각각 2.42~3.49%와 4.90~7.78%였다. 본 연구결과에서 다종농약 다성분 분석법을 이용한 hexaconazole분석은 매우 정확하고, 높은 재현성을 보여, 농산물 중 hexaconazole 분석에 적용할 수 있을 것으로 판단된다.

Caliber persistent artery (CPA) is a vascular anomaly presenting as a bluish and pulsatile artery in the subepithelial tissue. Although the incidence of CPA was debated, many CPAs occurred in the perioral and facial tissues at which the embryonal strapedial artery networks were distributed. The present study demonstrated a case of CPA occurred in the retromolar buccal mucosa in a 37 years old male. The lesion showed many pinkish granular spots, but was asymptomatic except biting irritation during mastication. It had slowly increased in size up to 20 × 25 mm for 3 years, and recently became hemorrhagic due to the biting injury between left upper and lower second molars. With the fear of oral cancer an incisional biopsy was performed, and followed by histological and immunohistochemical study. Histologically the lesion showed many tortuous artery localized at the submucosa area, and the arterial wall was thick and its lumen was narrowed and shrunken. In the immunochemistry α-SMA was positive for thick smooth muscle layer of artery and arterioles, TGase 2 was weakly positive for the luminal surface of arterial intima, and bFGF was consistently positive for the perivascular fibrous tissue. But PCNA, VEGF, CD31, CMG2, TGF-β1, HSP-70, and 14-3-3 were almost negative for the vascular tissue. Therefore, it was presumed that the lesion was not actively proliferative nor degenerative but still retained its cellular stability and slow growing potential. It was finally diagnosed as CPA differentially from arterio-venous malformation, hemangioma, lymphangioma, and squamous cell carcinoma. The retromolar buccal mucosa CPA is first reported in this study and may present usual clinical findings depending on its size and location. This asymptomatic lesion could be severely hemorrhagic by minor biting injury, therefore, precise differential diagnosis should be made through biopsy, and careful therapy be followed.

A sea urchin was collected from 140 m deep at Gapado which is nearby Moseulpo in Jejudo Island, Korea on 30 June 2010. This specimen was classified as Echinolampas koreana H.L. Clark 1925, belonging to family Echinolampadidae of order Echinolampadoida based on its morphological characteristics. This order and lower categories are newly recorded from Korea. Distinct morphological characters of this species are as follows: test is relatively high. Abactical system has four large genital pores. Periproct is slightly sunken and situated below equator line. Peristome is very small and rather deeply sunken. Tridentate and ophiocephalous pedicellariae are present. Color in alcohol is light purple. These morphological characters are re-described with illustrations.

A 57 years old female received xenogenic bone graft for the extraction socket augmentation of right maxillary molars and for the sinus floor elevation six months ago. The bone graft sites were healed uneventfully and showed marked radiopacity in the postoperative X-ray view. Before dental implant insertion the bone biopsy was made using trephine bur and examined pathologically. The graft bones showed minimum new bone deposition with dysplastic epithelium. The epithelium was proliferative on the surface of graft bones forming epithelial strands and nests, similar to the odontogenic epithelium. The immunohistochemical study was performed using different antisera of odontogenic markers, growth factors, oncogenes, etc. The epithelial cells were strongly positive for pan-keratins, EGF, pAKT, and HSP-70, consistently positive for PCNA, p53, EGFR, 14-3-3, and survivin, slightly positive for ameloblastin, but rarely positive for amelogenin. Particularly the matrix of graft bone was slightly positive for EGF. Taken together, it is presumed that the abnormal epithelium on the graft bones was derived from odontogenic epithelial elements, Malassez epithelial rests, distributed at the periodontal tissue of maxillary molars, and that they might undergo dysplastic proliferation affected by the release of growth factors and osteogenic proteins from the graft bones. It is also suggested that the graft bone substitutes inserted for the dental implant possibly have a potential to induce the proliferation of odontogenic epithelial rests leading to the pathogenesis of odontogenic cysts and tumors.

The purpose of this study is to examine the effects of gait training using functional electrical stimulation on the improvement of hemiplegic patients' functions for balance and gait velocity. The subjects of the experiment were determined to be 10 each hemiplegic patients who had been diagnosed with stroke or brain damage six months or longer earlier assigned to an experimental group and a control group respectively. The subjects were evaluated before the experiment using Tetrax and 10M gait tests, received gait training five times a week for four weeks using functional electrical stimulation and were evaluated after the experiment in the same method as used in the evaluation before the experiment. In order to examine differences between the experimental group that received gait training using functional electrical stimulation and the control group that was treated by functional electrical stimulation and received gait training thereafter, differences between before and after the experiment were analyzed using paired sample t-tests and differences in changes after the experiment between the experimental group and the control group were analyzed using independent sample t-tests in order to compare the two groups with each other. Experimental results showed significant differences in weight bearing, balance and gait velocity between before and after the experiment in the experimental group(p<.05). In the control group, whereas weight bearing and gait velocity did not show any significant difference between before and after the experiment(p>.05), balance showed significant differences(p<.05). Weight bearing, balance and gait velocity change rates showed significant differences between the experimental group and the control group(p<.05). In conclusion, it was indicated that gait training using functional electrical stimulation is effective for enhancing stroke patients' weight bearing rates, balance abilities and gait velocity.

The genomic structure and phylogenetic relationships of HSP88 genes from P. tenuipes Jocheon-1, P. tenuipes, C. militaris and C. pruinosa are described. The HSP88 genomic DNA from P. tenuipes Jocheon-1, P. tenuipes and C. militaris all contain 5 introns and 6 exons with the length of 13, 62, 32, 1438, 306, 288 bp, encoding 713 amino acid residues. C. pruinosa HSP88 genomic DNA contains 4 introns and 5 exons encoding 713 amino acids. The length of each exon of C. pruinosa HSP88 is 13, 62, 32, 1744, 288 bp and the length of exon 4 is identical to the total length of exon 4 and exon 5 of HSP88 of P. tenuipes Jochoen-1, P. tenuipes, and C. militaris. The deduced amino acid sequence of P. tenuipes Jocheon-1 HSP88 showed 99% identity with the P. tenuipes, 97% identity with the Cordyceps militaris, and 98% identity with the C. pruinosa. Phylogenetic analysis confirmed that the P. tenuipes Jocheon-1, P. tenuipes, C. militaris and C. pruinosa HSP88 are placed together within the ascomycetes group of fungal clade.

In this study, a full-length heat shock protein88 complementary DNA (cDNA) of Paecilomyces tenuipes Jocheon-1 was obtained by screening of P. tenuipesJocheon-1 Uni-Zap cDNA library and 5' RACE polymerase chain reaction. The Paecilomyces tenuipes Jocheon-1 heat shock protein88 cDNA contains an open reading frame of 2,139 bp encoding 713 amino acid residues. The deduced amino acid sequence of the P. tenuipes Jocheon-1 HSP88 cDNA showed 77% identity to N. haematococca HSP88 and 45-76% identity to other fungi HSP88. Phylogenetic analysis and BLAST program analysis confirmed that the deduced amino acid sequences of the P. tenuipes Jocheon-1 HSP88 gene belonged to the ascomycetes group within the fungal clade and P. tenuipes Jocheon-1 HSP88 also contains the conserved ATPase domain at the N-terminal. The cDNA encoding P. tenuipes Jocheon-1 HSP88 was expressed as a 88 kDa polypeptide in baculovirus-infected insect Sf9 cells. Under different stress conditions, mRNA expression of P. tenuipes Jocheon-1 HSP88 were quantified by real-time PCR and the result showed that heat shock stress affected the mRNA expression levels of P. tenuipes Jocheon-1 HSP88.

Presently, We have constructed an olig-d(T) primed directional cDNA library from the silkworm Dongchunghacho, an entomopathogenic fungus, of which species is belonging to Paecilomyces tenuipes Jocheon-1. To isolate and screen genes in the fungus, 626 expressed sequence tags(ESTs) were generated by a partial sequencing from the cDNA library. Paecilomyces tenuipes Jocheon-1 cDNA encoding the glyceraldehyde-3-phosphate dehydrogenase(Pt-GAPDH) of Paecilomyces tenuipes Jocheon-1 was cloned from the above cDNA library. The complete cDNA sequence of Pt-GAPDHis comprised of 1,014bp encoding 338 amino acid residues. The deduced protein sequence of Pt-GAPDH showed higher homology with Beauberia bassiana-GAPDH(93% amino acid identity). Hydropathy analysis revealed that Pt-GAPDH protein is hydrophilic. The major three amino acids in its composition of amino acid residues were alanine(11.54%), valine(9.47%) and glycine(8.88%). The cDNA encoding Pt-GAPDH was expressed as a 37 kDa polypeptide in baculovirus-infected insect Sf9 cells. The Pt-GAPDH gene of Paecilomyces tenuipes entomopathogenic fungus consisted of three exons and two introns coding for 338 amino acid residues, and the genomic DNA length of the gene spans 1302bp. The accession number of the gene in GenBank are GU997099 for Pt-GAPDH cDNA and GU997102 for Pt-GAPDH genomic DNA.

Fungi belonging to the Paecilomyces spp. have recently been used as food and herbal medicines in Korea and are greatly popular as commercially available powdered supplement or dried fruiting body. Despite this acceptance and its use, little is known of the genes related to its reactive agents. Presently, We have constructed an olig-d(T) primed directional cDNA library from the silkworm Dongchunghacho, an entomopathogenic fungus, of which species is belonging to Paecilomyces spp. based on the previous identification of ITS1 and ITS2 at the molecular level and collected from Jocheon Miryang, Korea. To isolate and screen genes in the fungus, 626 expressed sequence tags(ESTs) were generated by a partial sequencing from the cDNA library. cDNA encoding the glyceraldehyde-3-phosphate dehydrogenase(Pt-GAPDH) of Paecilomyces tenuipes- Jocheon was cloned from the above cDNA library. The complete cDNA sequence of Pt-GAPDH is comprised of 1,014bp encoding 338 amino acid residues. The deduced protein sequence of Pt-GAPDH showed higher homology with Beauberia bassiana-GAPDH(93% amino acid identity). Hydropathy analysis revealed that Pt-GAPDH protein is hydrophilic. The major three amino acids in its composition of amino acid residues were alanine(11.54%), valine(9.47%) and glycine(8.88%). The Pt-GAPDH gene of Paecilomyces tenuipes entomopathogenic fungus consisted of three exons and two introns coding for 338 amino acid residues, and the genomic DNA length of the gene spans 1302bp. The accession number of the gene in GenBank are GU997099 for Pt-GAPDH cDNA and GU997102 for Pt-GAPDH genomic DNA. More investigation works including gene expression, immunological analysis etc. will be carried continuously without hesitation after this presentation.

A full genomic DNA microarray technique was employed to investigate the effects of Dongchunghacho on aortal and hepatic gene expression in apolipoprotein E knockout mice fed a high-fat/high-cholesterol diet. Male 8- week - old ApoE-/- mice were randomly divided into two groups, control(high cholesterol group; HC) and supplementation of Dongchunghacho (SD). All of the mice were fed a high-fet/high cholesterol diet with or without Dongchunghacho supplemented by 1% for 6 weeks. At first, lipid profile of the Dongchunghacho was measured by biochemical analysis. No differences were observed in serum triglyceride and total cholesterol levels between the two groups. Antigenotoxic effect of the Dongchunghacho was measured by the single cell gel electrophoresis assay (Comet assay) and quantified as % fluorescence in tail. Dongchunghacho supplementation decreased significantly leukocytic DNA damage and also there was a tendency of reduction in hepatic DNA damage in Dongchunghacho group compared with the control group. In up regulated genes in liver and aorta of the mice, genes with 0 to 2- fold difference in expression level between the two group (HD and SD) was very much more in liver than in aorta, on the contrary, those with 2-fold to 16-flod difference increased greatly rather in aorta than in liver. Also, almost the same results were observed in down regulated genes in liver and aorta between the two groups. These results suggested that supplementation of Dongchunghacho might be helpful in preventing leukocytic DNA damage induced by high fat diet, and has a more crucial roles in aortal gene expression.

Al thou gh it was reported that the human genome had been entirely seq uenced. so far there frequently appeared non - redundant cDNAs in gene cloning of cellular mRNAs. Consequently a lot of effort is required to ide ntified the new genes for theil‘ localization in chromosome and their functlons If the new genes had small size sequences 0 1' were expressed in low level , 5' RACE became ha rd unexpectedly. Here. we demonstrated a new method of 5’ RACE by PCR cloning using hair pin prime r and cDNA template produced by gene specific primer. Firstly .. total RNA obtained from tissue 0 1' cells is primed for rever se transcri ption (Superscript lI) by antisense primer (AS-l) specilïc to the objective gen e in order to produce single strand cDNAs The cDNAs usua lly have 3' overhanging of CCC seq uence. SeconcUy, a hail‘ pin primer overhang GGG seq uence in 3' end (i .e ‘ Tn'AGTGAGGGTTA AGAAGGAGAATTAACCCTCACTAAAGGG) is rnixed with the cDNA produced above, and 1'01- lowed by heating at 70'C for 5 min and cooled in room temperature to make hairpin-end template cDNAs Thirdly, For PCR is performed using the ha irpin-end template cDNAs and primer set of inner hairpin sense primer (i . e., TAACCCTCACTA AAGGGG) and AS-1 using pfu polymerase. And next. the PCR product can be directly sequenced 0 1' subcloned into vector to seq uence the purified plasrnid DNA. In our laboratory several unidentified new genes have been under investigation for theil‘ genomic l oci and functions. However. one of them. a human short helical protein 1 (hSHP-1) was a short gene less than 600 bp in s ize. encoding 45 amino acids . hSHP-1 is able to produce a potent antimicrobial peptide which has similar strength to magainin from frogs. The hSHP-1 also showed multifunctional roles of innate imrnunity including not only the ant imicrobial activity against methi cillin resistant strains but a lso anti- neoplastic effect on precance rous cell s . Fluorescence in situ hybricli zation in chromosome was not successful due to weak signal. and genornic Southern of hSHP-l showecl a higher weak bancl. which is not clearly definecl as an comrnon genomic locus‘ but could be cons idered its or igin from centromere region which contains less frequent restri ction sites. And more, th e ordinary PCR cloning performed pre vious ly from human genornic DNA produced only repetitive non-specific DNAs which were not matched to hSHP-l cDNA This study demonstrated how we have don e the PCR cl oning usi ng ha irpin primer and cDNA template reve rsely transcribed by gene specific primer.

om llnique miRNA encoding genes and also from intergene seqllences. 80 far it is generally suggestecl that one miRNA could target multiple genes. and also several miRNAs could be orchestrated to downregulate a s pecific gene. However. there would be many possibilities to procluce more miRNAs and to target gene in more compli catecl manners tha n we expected Here‘ we developed a detection program of miRNA consensus sequences from non- cocling region of genetic corcls As the ha irpin structure 01' tRNA has step-loop like hybridi zation by a single strand RNA. the repeated 3-5 nt symmetric arrangement with 6- 12 nt spanning sequences for hail‘pin head is necessary to form a preCllrsor rruRNA The DNA base pair‘ polarity program symbolizecl by the electrostatic polarities of pyrimidine and purine is now reinforcecl by the cletection program fOI symmetric DNA strand from non-coding regions. For example, we iclentifi ecl candidate miRNAs targeting eIF5A mRNA (miR-eIF5A-l)‘ 288 ribosomal RNA (miR- 28S-1). and dentin sialophosphate protein mRNA (miR- D8PP-1). 1n t his study the detection methocl of 288 ribosomal RNA was demonstrated ancl the molecular biological effects 01' miRNA targeting in vitro culture system were evaluatecl by miRNA RT• PCR, Northen blot, siRNA interference, and in situ hybridization. We firstly sea rched the candidate miRNA from the intron sequences of each objectiγe gene using the programs of syrrunetric sequence cletection a ncl DNA base pair polarity, ancl secondarily siRNA procluced by in vitro transcription and inclucible lenti virus vector cons tru ction was transfectecl into HEK293 cells. The transfectecl siRNA of miR-28S-1 was accumulated in the nucleoli ancl inclllced apoptosis extens ively in 2 days cultur8. Northern blot using miR-288-1 probe showed strong reaction in t he 288 bancJ of total RNA and also showed a smeared band in small size representing the presence of t he precursor and mature miRNAs 이 miR-288-1. In in situ hyridi zation most of cells revealed intensive miR-288-1 positive reaction in their cytopl asms. mirni cking t he abllndant localization of 288 RNA From the above study. we presume that rniRNAs targeting s pecific genes are possibly derivecl from the in tron seq uences of the objective gene, and suggest that the symmetirc sequence detect ion ancl DNA base pair polarity program is useflll to define the candiclate miRNA