An 81-years-old woman presented multiple mucosa ulcers with a chief complaint of pain during wearing the lower denture. She had been wearing upper and lower complete dentures for five months, and received multiple drugs for the treatment of angina pectoris, constipation, neurosis, hypertension and arthritis (calcium channel blockers, furosemide, captopril, nonsteroidal anti-inflammatory agents and penicillamine, respectively), but no history of immune-diseases and viral infection symptom. The present lesion was primarily diagnosed as traumatic ulcer, candidiasis and lichen planus in the clinical observation, thereby conservatively treated with denture relining, antifungal agent, and steroidal agent. However, the ulcer lesion was not healed for two months and rather increased in size. With the diagnosis of viral infection the immunohistochemical (IHC) staining of IL28 and E6, and polymerase chain reaction (PCR) using herpes simplex virus (HSV)-1 primer sets was done but entirely showed negative reaction. Therefore, with the patient’s medical history and IHC findings exhibiting strong positive reaction of CD3 and CD28, but rare/weak reaction of NFkB, CD20, IgK and p38, the ulcer lesion was finally diagnosed as drug-induced pemphigoid ulceration which was not an inflammatory granulomatous lesion but related to the retrogressive acantholytic degeneration of epithelial cells caused by multiple drug abuse.
The aim of the present study was to investigate sex- and age-associated clinico-metabolic characteristics of urinary stone patients. A retrospective review was performed on data from 2,009 consecutive patients presenting with their first urinary stone episode between 2005 and 2013. Of the 2,009 patients, 1,426 (71.0%) satisfied the inclusion criteria and were enrolled in the study. Patients were grouped by age (<60, ≥60 years old) and sex. The medical history and 24 hr urinary chemistry results of each patient were obtained. The mean age of the 165 (11.6%) patients aged 60 or over was 65.5 ± 4.2 years. Body mass index was greater in elderly females than in younger females (p=0.031). After stratification by sex and age, lower urinary excretion of calcium and uric acid was a protective factor for both sexes among the elderly (p<0.05, each, respectively). Low urine pH was a common risk factor for both sexes among the elderly (p=0.013 in males, p=0.047 in females, respectively), whereas lower citrate excretion was a risk factor for only the elderly female group (p=0.004). With regard to urinary metabolic abnormalities, elderly females showed higher incidence of hypocitraturia compared to younger females (p=0.049). In conclusion, this study demonstrated the sex- and age-associated clinico-metabolic characteristics of urinary stone patients. Thus, it is important to tailor metabolic evaluation and medical prevention therapies for patient according to sex and gender characteristics.
In order to know the characteristic roles of salivary protein complex (SPC) the gel-filtration chromatography was performed using the unstimulated and the stimulated whole saliva separately. The first and second dominant SPC peaks were fractionated and analyzed by immunoprecipitation HPLC (IP-HPLC) using antibodies against the essential salivary proteins including α-amylase, mucin-1, proline rich proteins (PRPs), histatin, cystatin, LL-37, lysozyme, lactoferrin, -defensin-1, -2, -3, IgA, transglutaminase 4 (TGase 4), mucocidin, α1-antitrypsin, cathepsin G. In the gel-filtration chromatography the stimulated whole saliva showed much reduced amount of SPCs than the unstimulated whole saliva, but the proportional patterns of both whole saliva were almost similar each other. Through IP-HPLC analysis both of the first and second dominant SPCs were variably positive for the essential salivary proteins, however, α-amylase, mucin-1, PRPs, lysozyme, and cathepsin G were predominant in the first dominant SPC, while cystatin, lactoferrin, β-defensin-1, -2,-3, IgA, mucocidin, TGase 4, and α1-antitrypsin were predominant in the second dominant SPC. And more, the α1-antitrypsin and cathepsin G which were mostly derived from gingival crevicular fluid were also consistently found in the SPCs. These data may suggest that the first dominant SPC, rich in α-amylase, mucin-1, PRPs, lysozyme, and cathepsin G, may play a role in food digestion, protein degradation, and mucosa lubrication, while the second dominant SPC, rich in cystatin, lactoferrin, β-defensin-1, -2, -3, mucocidin, IgA, TGase 4, and α1-antitrypsin, may play a role in the mucosa protection and antimicrobial defense.
The purpose of this study is to explore one bilingual person’s language development in relation to the changing environments in which she has lived. Bronfenbrenner's (1977, 1979, 1992) bioecological model provided insight as a theoretical framework in that the model emphasizes active interactions and strong interconnectedness between the individual and her surrounding environments, as well as interactions among environments (micro, meso, exo, and macrosystem). As a main data source, a two and half hour semi-structured interview was conducted with the participant, who is a Korean-English bilingual pursuing a graduate degree at an American university. The analysis of the interview data revealed that 1) the participant's developing characteristics (e.g., outgoing personality, age of language learning), 2) the changing environments (e.g., parents’ belief and philosophy, home residential location), and 3) the interactions between the participant and her environments (e.g., the participant’s intrinsic motivation and the mother’s philosophy) and interactions between inner and outer environments (e.g., school system and national educational policy) played out for the participant's reach on the current language development in Korean and English.
Caliber persistent artery (CPA) is a vascular anomaly presenting as a bluish and pulsatile artery in the subepithelial tissue. Although the incidence of CPA was debated, many CPAs occurred in the perioral and facial tissues at which the embryonal strapedial artery networks were distributed. The present study demonstrated a case of CPA occurred in the retromolar buccal mucosa in a 37 years old male. The lesion showed many pinkish granular spots, but was asymptomatic except biting irritation during mastication. It had slowly increased in size up to 20 × 25 mm for 3 years, and recently became hemorrhagic due to the biting injury between left upper and lower second molars. With the fear of oral cancer an incisional biopsy was performed, and followed by histological and immunohistochemical study. Histologically the lesion showed many tortuous artery localized at the submucosa area, and the arterial wall was thick and its lumen was narrowed and shrunken. In the immunochemistry α-SMA was positive for thick smooth muscle layer of artery and arterioles, TGase 2 was weakly positive for the luminal surface of arterial intima, and bFGF was consistently positive for the perivascular fibrous tissue. But PCNA, VEGF, CD31, CMG2, TGF-β1, HSP-70, and 14-3-3 were almost negative for the vascular tissue. Therefore, it was presumed that the lesion was not actively proliferative nor degenerative but still retained its cellular stability and slow growing potential. It was finally diagnosed as CPA differentially from arterio-venous malformation, hemangioma, lymphangioma, and squamous cell carcinoma. The retromolar buccal mucosa CPA is first reported in this study and may present usual clinical findings depending on its size and location. This asymptomatic lesion could be severely hemorrhagic by minor biting injury, therefore, precise differential diagnosis should be made through biopsy, and careful therapy be followed.
A 57 years old female received xenogenic bone graft for the extraction socket augmentation of right maxillary molars and for the sinus floor elevation six months ago. The bone graft sites were healed uneventfully and showed marked radiopacity in the postoperative X-ray view. Before dental implant insertion the bone biopsy was made using trephine bur and examined pathologically. The graft bones showed minimum new bone deposition with dysplastic epithelium. The epithelium was proliferative on the surface of graft bones forming epithelial strands and nests, similar to the odontogenic epithelium. The immunohistochemical study was performed using different antisera of odontogenic markers, growth factors, oncogenes, etc. The epithelial cells were strongly positive for pan-keratins, EGF, pAKT, and HSP-70, consistently positive for PCNA, p53, EGFR, 14-3-3, and survivin, slightly positive for ameloblastin, but rarely positive for amelogenin. Particularly the matrix of graft bone was slightly positive for EGF. Taken together, it is presumed that the abnormal epithelium on the graft bones was derived from odontogenic epithelial elements, Malassez epithelial rests, distributed at the periodontal tissue of maxillary molars, and that they might undergo dysplastic proliferation affected by the release of growth factors and osteogenic proteins from the graft bones. It is also suggested that the graft bone substitutes inserted for the dental implant possibly have a potential to induce the proliferation of odontogenic epithelial rests leading to the pathogenesis of odontogenic cysts and tumors.
This study has investigated the effect of isometric contractile force and muscle activity applying sperficial heat according to the time from the biceps brachii muscle. In this study, 20 university students participants without musculoskeletal and neurological disorders. By applying a hot pack 5min, 10min, 20min and 30min respectively. After that measurement are skin temperature, contractile force and muscle activity. Skin temperature of the hot 5 min applied that rapidly changing. Increasing the time it takes to apply a variance has been reduced(p<.001). Isometric contractile force was not statistically significant but highest when applying the hot pack 5 minutes and lowest when applying the hot pack 30 minutes(p<.001). Muscle activity and median frequency was highest when applying the hot pack 5 minutes. To analyze the above results, it was found that isometric contractile force and muscle activity changed according to the applying time. These result lead us to the conclusion that this study will be more evidence for changes in muscle contraction to apply hot pack on clinic.
With escalating economic growth during the last three decades, flower industry of China, especially cut flower is sharply developed. In this paper a brief review of the cut flower current situation of globe and current status of flower industry of China especially of cut flower in the world is presented. The acreage, yield, potential of cut flower in China along with distribution of major cut flower products and constraint of cut flower also was indicated in this paper was also presented.
본 연구는 특허정보활용과 연구개발활동 사이의 관계에 대한 분석을 위해, 국가연구개발사업을 대상으로 특허기술동향조사가 국가연구개발사업의 성과에 미치는 영향을 기술적 성과인 특허성과에 집중하여 그 영향을 추정하였다. 정부는 2005년부터 국가연구개발사업에 대하여 특허기술동향조사사업을 시행하고 그 범위를 확대해 왔다. 특허기술동향조사사업은 국가연구개발사업의 기획단계 또는 과제 선정단계에서 특허 동향 및 선행기술에 대한 정보를 제공하여 중복 투자, 유사기술 개발의 가능성을 줄여 국가연구개발사업의 효율성과 성과를 제고하기 위한 사업이다. 이러한 특허기술동향조사가 국가연구개발사업의 기술적 성과에 어떠한 효과를 지니는지를 투입요소, 개발주체의 특성, 자금의 공급자 요인을 고려한 모형을 사용하여 추정하였다. 2005년부터 2008년까지 국가연구개발사업의 성과 자료와 특허기술동향조사사업에 대한 자료를 바탕으로 특허기술동향조사 사업의 효과를 추정한 결과, 선행기술조사는 국내 및 해외 특허의 출원 및 등록 성과를 유의하게 제고하는 것으로 밝혀졌다. 이러한 결과로부터 국가연구개발사업에서 특허정보활용을 통해 기술적 성과의 제고가 가능하다는 점을 알 수 있다. 이는 특허정보활용을 통해 국가연구개발사업의 효율성과 효과성이 제고되었음을 보여준다.
국화는 개화를 위해서는 30일의 지속적인 단일 처리가 요구되는 원예작물인데 본 연구에서는 국화의 화형별 홑꽃 타입의 ‘Limelight’, ‘Sunlight’, ‘Candle Light’, ‘Firebrand’, ‘Twilight’와 겹꽃 타입의 ‘Spirit’, ‘Sunburst Spirit’, ‘Mandalay’, ‘Illini Harvest’가 단일 (SD)−장일 (LD)−단일 (SD)의 일장 처리가 생장 및 개화조절 반응에 미치는 효과를 알아보고자 수행되었다. 30일간의 단일 처리와 5일 또는 10일 동안의 장일처리 후 5일 또는 10일 동안의 단일조건을 각각 처리하였다. 품종별 차이는 없었으나 5 SD−10 LD−25 SD 처리는 개화를 지연 시키고 설상화 수가 증가되었다. 특히 ‘Firebrand’와 ‘Candlelight’ 품종의 설상화 수는 각각 40개와 60.8개로 대조구에 비해 현저히 증가되었다. 또한 SD−LD−SD 처리는 개화를 6일에서 7일정도 지연시키는 것 외에는 큰 효과를 나타나지 않았다. 그러나 ‘Illini Harvest’와 ‘Limelight’의 설상화 수는 어떤 SD−LD−SD 처리에 의해서도 증가되지 않았다. 따라서 추후 새로운 품종별 일장처리에 따른 추가적인 연구 분석이 뒤따라야 할 것으로 판단되며 본 연구 결과는 국화의 신품종 육성을 위한 자료에 유용함을 알 수 있었다.
Al thou gh it was reported that the human genome had been entirely seq uenced. so far there frequently appeared non - redundant cDNAs in gene cloning of cellular mRNAs. Consequently a lot of effort is required to ide ntified the new genes for theil‘ localization in chromosome and their functlons If the new genes had small size sequences 0 1' were expressed in low level , 5' RACE became ha rd unexpectedly. Here. we demonstrated a new method of 5’ RACE by PCR cloning using hair pin prime r and cDNA template produced by gene specific primer. Firstly .. total RNA obtained from tissue 0 1' cells is primed for rever se transcri ption (Superscript lI) by antisense primer (AS-l) specilïc to the objective gen e in order to produce single strand cDNAs The cDNAs usua lly have 3' overhanging of CCC seq uence. SeconcUy, a hail‘ pin primer overhang GGG seq uence in 3' end (i .e ‘ Tn'AGTGAGGGTTA AGAAGGAGAATTAACCCTCACTAAAGGG) is rnixed with the cDNA produced above, and 1'01- lowed by heating at 70'C for 5 min and cooled in room temperature to make hairpin-end template cDNAs Thirdly, For PCR is performed using the ha irpin-end template cDNAs and primer set of inner hairpin sense primer (i . e., TAACCCTCACTA AAGGGG) and AS-1 using pfu polymerase. And next. the PCR product can be directly sequenced 0 1' subcloned into vector to seq uence the purified plasrnid DNA. In our laboratory several unidentified new genes have been under investigation for theil‘ genomic l oci and functions. However. one of them. a human short helical protein 1 (hSHP-1) was a short gene less than 600 bp in s ize. encoding 45 amino acids . hSHP-1 is able to produce a potent antimicrobial peptide which has similar strength to magainin from frogs. The hSHP-1 also showed multifunctional roles of innate imrnunity including not only the ant imicrobial activity against methi cillin resistant strains but a lso anti- neoplastic effect on precance rous cell s . Fluorescence in situ hybricli zation in chromosome was not successful due to weak signal. and genornic Southern of hSHP-l showecl a higher weak bancl. which is not clearly definecl as an comrnon genomic locus‘ but could be cons idered its or igin from centromere region which contains less frequent restri ction sites. And more, th e ordinary PCR cloning performed pre vious ly from human genornic DNA produced only repetitive non-specific DNAs which were not matched to hSHP-l cDNA This study demonstrated how we have don e the PCR cl oning usi ng ha irpin primer and cDNA template reve rsely transcribed by gene specific primer.
om llnique miRNA encoding genes and also from intergene seqllences. 80 far it is generally suggestecl that one miRNA could target multiple genes. and also several miRNAs could be orchestrated to downregulate a s pecific gene. However. there would be many possibilities to procluce more miRNAs and to target gene in more compli catecl manners tha n we expected Here‘ we developed a detection program of miRNA consensus sequences from non- cocling region of genetic corcls As the ha irpin structure 01' tRNA has step-loop like hybridi zation by a single strand RNA. the repeated 3-5 nt symmetric arrangement with 6- 12 nt spanning sequences for hail‘pin head is necessary to form a preCllrsor rruRNA The DNA base pair‘ polarity program symbolizecl by the electrostatic polarities of pyrimidine and purine is now reinforcecl by the cletection program fOI symmetric DNA strand from non-coding regions. For example, we iclentifi ecl candidate miRNAs targeting eIF5A mRNA (miR-eIF5A-l)‘ 288 ribosomal RNA (miR- 28S-1). and dentin sialophosphate protein mRNA (miR- D8PP-1). 1n t his study the detection methocl of 288 ribosomal RNA was demonstrated ancl the molecular biological effects 01' miRNA targeting in vitro culture system were evaluatecl by miRNA RT• PCR, Northen blot, siRNA interference, and in situ hybridization. We firstly sea rched the candidate miRNA from the intron sequences of each objectiγe gene using the programs of syrrunetric sequence cletection a ncl DNA base pair polarity, ancl secondarily siRNA procluced by in vitro transcription and inclucible lenti virus vector cons tru ction was transfectecl into HEK293 cells. The transfectecl siRNA of miR-28S-1 was accumulated in the nucleoli ancl inclllced apoptosis extens ively in 2 days cultur8. Northern blot using miR-288-1 probe showed strong reaction in t he 288 bancJ of total RNA and also showed a smeared band in small size representing the presence of t he precursor and mature miRNAs 이 miR-288-1. In in situ hyridi zation most of cells revealed intensive miR-288-1 positive reaction in their cytopl asms. mirni cking t he abllndant localization of 288 RNA From the above study. we presume that rniRNAs targeting s pecific genes are possibly derivecl from the in tron seq uences of the objective gene, and suggest that the symmetirc sequence detect ion ancl DNA base pair polarity program is useflll to define the candiclate miRNA
[n order to obtain the trlle expected DNA prod uct from PCR and RT-PCR using genornic DNA or cDNA reversely transcribed from mRNA. the PCR should be done in an appropriated condition. Sometimes the PCR was repeatedly fail ed. and cventllally the PCR product was turned out to be nonspecific and rudimentary . And more‘ t he PCR prodllctwas not reproducible even though careflll repeat of experiments. As the PCR was based on the exact primel hybridization. the condition of primer hybridization should be properly controlled by a nnealing temperatllre. But the selection of primer seqllences for targeting a specific gene is mostly important. A new method of primer eval uation is now available llsing DNA base pair polarity program. This study presents an example of PCR targeting to human Bax gene using genomic DNA. The DNA base pair polarity theory can di vide the genetic cord into propel DNA segments and calclllaLe their DNA base pair hybridization energy. Thus. mathematically the degree 0(' exact primer hybridization can be expected for the t r1l8 targeting of PCR. However, the DNA base pair polal'ityanalysis demonstrates that the more frequent number of DNA segment incl'eased the specificity of PCR. but decreased its sensitivity . While the greater polarity of DNA segment composed of increased nllmber of polarized DNA base pairs showed increased sensitivi ty 0 1' PCR. bllt relati vely decreased specificity of PCR. With the mllltiple analysis of PCR. especially for PCR cloning from the gDNA and cDNA, we found that the primers themselves showed secondary strllcture of partial hybridization between sameprimers or each pair primers. The DNA base pail‘ polarity signal can directly demonstrated symmetric sequences 0 1' each primer. and also can distinguish the dimmer formation from each pair primers. At least the symmetric seqllence of fOlll‘ base pairs dramatically showed the dimrner formation. On the other hand. in addi tion Lo the statlls of DNA base pair polarity the three-dimensional strllctllre of DNA dOllble helix targeted by the primer seqllences may affect the sensitivity and specificity of PCR detection. The present study introduced a new method of primer evalllation and selection in order to obtain abundant and exacL! y-trlle DNA product for genomic ffilltation analysis and gene expression profï le
The present study investigated the effects of follicle stimulating hormone (FSH) and human chorionic gonadotrophin (hCG) on the nuclear maturation of canine oocytes. Oocytes were recovered from mongrel female ovaries in various reproductive states; follicular, luteal or anestrous stage. Oocytes were cultured in serum-free tissue culture medium (TCM)-199 supplemented with various concentrations of FSH (Exp. 1: 0, 0.5, 1.0 or 10 IU) or hCG (Exp. 2: 0, 0.5, 1.0 or 10 IU) or both (Exp. 3: 1 IU FSH + 1 IU hCG) for 72 hr to determine the effective concentration of these hormones, and to examine their combined effect. After maturation culture, oocytes were denuded in PBS containing 0.1% (w/v) hyaluronidase by gentle pipetting. The denuded oocytes were stained with 1.9 μM. Hoechst 33342 in glycerol and the nuclear state of oocytes was evaluated under UV light. More (p<0.05) oocytes matured to MII stage when follicular stage oocytes were supplemented with 1 IU FSH (6.2%) compared with the control, 0.1 or 10.0 IU FSH (0 to 1.2%). Significantly higher (p<0.05) maturation rate to MII stage was observed in follicular stage oocytes supplemented with 1.0 IU hCG (7.2%) compared with the control or other hCG supplemented groups (0 to 1.5%). However, the combination of FSH and hCG did not improve the nuclear maturation rate of canine oocyte (2.4 %) compared with FSH (6.2%) and hCG alone (7.2%). In conclusion, FSH or hCG alone significantly increased the maturation of canine oocytes to MII stage.
Immuno-MemBlot is a technique for detecting, analyzing, and identifying proteins, similar to the Western blot technique but differing in that protein samples are not separated electrophoretically but are spotted through circular or slot templates directly onto the membrane. Recently we developed a new Immuno-MemBlot (IMB) method applying immunoreactions and coloring procedures directly in the wells of MemBlot apparatus, which were connected by canals to perform drainage for reagent application and buffer irrigation. This IMB method was designed to get theimmunoblot results more rapidly and clearly than the previous immunoblot ones. This study is aimed to evaluate the analytical accuracy of IMB using different biological assay. In the sensitivity test of IMB the monoclonal antibody can clearly detect the 30 ng (about 12 pM) of Mucocidin peptide (35 mer), and is also available to detect at least 10 ng (about 4 pM) of Mucocidin peptide (35 mer). The IMB was effective in the quantitative analysis of methothrexate (MTX) assay for cellular apoptosis. And more, this IMB is useful to screen large number of specific samples with ease and accuracy in a short time. In the screenings for the presence of Mucocidin in saliva the quantitative comparison is conspicuous among 48 persons depend on the different conditions ofgender, drinking and smoking habits, and oral diseases. Therefore, it is presumed that, even though the target proteins were partly degraded, a specific epitope can be detected if a monoclonal antibody was still reactive. Conclusively, these data suggest that the IMB can be useful in the primary qualitativeand quantitative analysis of proteins in various fluids, i.e., blood, saliva, tear, urine, etc.