Single crystalline Cu nanowires with controlled diameters and aspect ratios have been synthesized using electrochemical deposition within confined nanochannels of a porous anodic aluminium oxide(AAO) template. The diameters of nano-sized cylindrical pores in AAO template were adjusted by controlling the anodization conditions. Cu nanowires with diameters of approximately 38, 99, 274 nm were synthesized by the electrodeposition using the AAO templates. The crystal structure, morphology and microstructure of the Cu nanowires were systematically investigated using XRD, FE-SEM, TEM and SAED. Investigation results revealed that the Cu nanowires had the controlled diameter, high aspect ratio and single crystalline nature.
This study aimed to investigate the characteristics of pre-service elementary teachers' understanding about scientific inquiry in terms of designing exploration and reasoning that is used to formulate explanations based on evidence. The research context was an open inquiry with using the Science Writing Heuristic (SWH) template in which participant students were not provided with inquiry questions. As data, lab. 39 pre-service elementary teachers participated in this study while taking their science methods course. Analyses of the reports were framed by the cognitive processes of inquiry (Chinn and Malhotra, 2002) and each report was coded and analyzed by the framework of inquiry (Tytler and Peterson, 2004). Results showed that groups' works that utilized the SWH template encouraged the participants to interact each other about scientific inquiry. They came up with more relevant and testable questions for their scientific inquiry. It implicates that children will be able to have chances of testing their own questions more properly by using the SWH template in science classes just as the participants did in this study. The use of the SWH template would help pre-service teachers to teach appropriately how to test inquiry questions to their students in the future. Discussion was made to figure out the characteristics or Korean pre-service elementary teachers' understanding about scientific inquiry.
작은 고체 분체들은 피커링 유화 체계에서 안정화제로 작용하는 것은 이미 알려진 사실이다. 이 연구에서 우리는 알킬실란 처리 TiO2와 n-헥실알코올, 수계로 안정한 피커링 에멀젼을 제조하였다. TiO2 입자에 의해 안정화된 피커링 에멀젼을 제조하기 위한 최적의 조건은 TiO2 입자의 양과 수상/유상의 비에 의해 결정된다. 피커링 에멀젼의 형태는 물과 n-헥실알코올에 대한 입자들의 젖음성에 의존된다. 피커링 에멀젼은 TiO2가 5.00 wt%, 오일과 수상의 비가 3 : 7인 경우에 가장 안정하였다. 피커링 에멀젼을 형판으로 하여 무기 전조체를 졸-겔 공정에 의해 다공성 분체들이 합성되었다. 합성된 다공성 분체들은 광학 현미경, SEM, BET, XRD 및 EDS에 의해 확인되었다.
Herein, macroporous carbon foams were successfully prepared with phenol and formaldehyde as carbon precursors and an ionic liquid, 1-butyl-3-methylimidazolium hexafluorophosphate (BMIPF6), as a pore generator by employing a polymerization-induced phase separation method. During the polycondensation reaction of phenol and formaldehyde, BMIPF6 forms a clustered structure which in turn yields macropores upon carbonization. The morphology, pore structure, electrical conductivity of carbon foams were investigated in terms of the amount of the ionic liquid. The as-prepared macroporous carbon foams had around 100-150 μm-sized pores. More importantly, the electrical conductivity of the carbon foams was linearly improved by the addition of BMIPF6. To the best of the author's knowledge, this is the first result reporting the possibility of the use of an ionic liquid to prepare porous carbon materials.
Nationally, flatfish vaccination has been performed manually, and is a laborious and time-consuming procedure with low accuracy. The handling requirement also makes it prone to contamination. With a view to eliminating these drawbacks, we designed an automatic vaccine system in which the injection is delivered by a Cartesian coordinate robot guided by a vision system. The automatic vaccine injection system is driven by an injection site location algorithm that uses a template-matching technique. The proposed algorithm was designed to derive the time and possible angles of injection by comparing a search area with a template. The algorithm is able to vaccinate various sizes of flatfish, even when they are loaded at different angles. We validated the performance of the proposed algorithm by analyzing the injection error under randomly generated loading angles. The proposed algorithm allowed an injection rate of 2000 per hour on average. Vaccination of flatfish with a body length of up to 500mm was possible, even when the orientation of the fish was random. The injection errors in various sizes of flatfish were very small, ranging from 0 to 0.6mm.
Herein, macroporous carbon materials were readily prepared by carbonization of cured body of resorcinol and formaldehyde using poly(methyl methacrylate) colloid microspheres which were employed as the template in the gelation of resorcinol with formaldehyde. The gel in the water was solvent exchanged with methanol and the wet gel was dried. After carbonization of the template-gel composite at , it was found that pores were left corresponding to the size of the template, yielding carbon materials with a fine porous structure with enlarged surface area and significant porosity. Properties of the carbon foams including the structure, morphology, thermal stability, and porosity were investigated. Finally, it was concluded that the method using polymer colloids as the template provided a facile route to prepare carbon foams.
As a growth-template of ZnO nanorods (NR), a hexagonal β-Ni(OH)2 nanosheet (NS) was synthesized with the low temperature hydrothermal process and its microstructure was investigated using a high resolution scanning electron microscope and transmission electron microscope. Zinc nitrate hexahydrate was hydrolyzed by hexamethylenetetramine with the same mole ratio and various temperatures, growth times and total concentrations. The optimum hydrothermal processing condition for the best crystallinity of hexagonal β-Ni(OH)2 NS was determined to be with 3.5 mM at 95˚C for 2 h. The prepared Ni(OH)2 NSs were two dimensionally arrayed on a substrate using an air-water interface tapping method, and the quality of the array was evaluated using an X-ray diffractometer. Because of the similarity of the lattice parameter of the (0001) plane between ZnO (wurzite a = 0.325 nm, c = 0.521 nm) and hexagonal β-Ni(OH)2 (brucite a = 0.313 nm, c = 0.461 nm) on the synthesized hexagonal β-Ni(OH)2 NS, ZnO NRs were successfully grown without seeds. At 35 mM of divalent Zn ion, the entire hexagonal β-Ni(OH)2 NSs were covered with ZnO NRs, and this result implies the possibility that ZnO NR can be grown epitaxially on hexagonal β-Ni(OH)2 NS by a soluble process. After the thermal annealing process, β-Ni(OH)2 changed into NiO, which has the property of a p-type semiconductor, and then ZnO and NiO formed a p-n junction for a large area light emitting diode.
Ni nanowires were fabricated using anodic aluminum oxide (AAO) membrane as a template by electrochemical deposition. The nanowires were formed within the walls of AAO template with 200 nm in pore diameter. After researching proper voltage and temperature for electrochemical deposition, the length of Ni nanowires was controlled by deposition time and the supply of electrolyte. The morphology and microstructure of Ni nanowires were investigated by field emission scanning electron microscope (FE-SE), X-ray diffraction (XRD) and transmission electron microscope (TEM).
DNA sequencer는 template로 이용하는 DNA의 quality와 sequencing 반응 산물의 정제 방법, 그리고 gel 농도에 민감하다고 알려져 있다. 이에 우리는 plasmid DNA의 준비, 정제, sequencing 반응, gel 농도와 injection medium 등에 대한 최적 조건을 구축하기 위한 연구를 수행하였다. Plasmid DNA 준비과정에서 phenol을 사용한 것 보다 chloroform을 사용한 것이 평균 reading length가 532 bp에서 684 bp로 향상 되었으며, 2.5% DMSO를 첨가한 것이 첨가하지 않은 것에 비해 200 bp 더 길게 염기서열 분석이 되었다. 또한, sequencing 반응산물 정제 시 50 mM EDTA와 0.6 M sodium acetate를 미리 섞어서 pH 8.0으로 맞춘 것을 사용한 것이 50 mM EDTA(pH 8.0)와 0.6 M sodium acetate(pH 5.2)를 각각 사용한 것 보다 20 bp 길게 염기서열 분석이 되었다. Injection medium으로는 실험실에서 resin으로 탈 이온화 시킨 formamide보다 정제된 ABI formamide를 사용한 것이 보다 재현성 있게 reading length가 90 bp 더 길게 분석 되었으며, 4% PAGE gel 보다 3.6% PAGE gel을 사용한 것이 150 bp 더 길게 분석 되었다. Template 준비 시 chloroform으로 정제하고 2.5% DMSO를 첨가, sequencing 반응산물 정제 시 carrier의 pH를 8.0으로 맞춘 것을 이용, 그리고 ABI formamide와 3.6% gel 농도를 사용하는 최적의 조건으로 평균 700 bp, 85% score를 얻을 수 있었다.
Al thou gh it was reported that the human genome had been entirely seq uenced. so far there frequently appeared non - redundant cDNAs in gene cloning of cellular mRNAs. Consequently a lot of effort is required to ide ntified the new genes for theil‘ localization in chromosome and their functlons If the new genes had small size sequences 0 1' were expressed in low level , 5' RACE became ha rd unexpectedly. Here. we demonstrated a new method of 5’ RACE by PCR cloning using hair pin prime r and cDNA template produced by gene specific primer. Firstly .. total RNA obtained from tissue 0 1' cells is primed for rever se transcri ption (Superscript lI) by antisense primer (AS-l) specilïc to the objective gen e in order to produce single strand cDNAs The cDNAs usua lly have 3' overhanging of CCC seq uence. SeconcUy, a hail‘ pin primer overhang GGG seq uence in 3' end (i .e ‘ Tn'AGTGAGGGTTA AGAAGGAGAATTAACCCTCACTAAAGGG) is rnixed with the cDNA produced above, and 1'01- lowed by heating at 70'C for 5 min and cooled in room temperature to make hairpin-end template cDNAs Thirdly, For PCR is performed using the ha irpin-end template cDNAs and primer set of inner hairpin sense primer (i . e., TAACCCTCACTA AAGGGG) and AS-1 using pfu polymerase. And next. the PCR product can be directly sequenced 0 1' subcloned into vector to seq uence the purified plasrnid DNA. In our laboratory several unidentified new genes have been under investigation for theil‘ genomic l oci and functions. However. one of them. a human short helical protein 1 (hSHP-1) was a short gene less than 600 bp in s ize. encoding 45 amino acids . hSHP-1 is able to produce a potent antimicrobial peptide which has similar strength to magainin from frogs. The hSHP-1 also showed multifunctional roles of innate imrnunity including not only the ant imicrobial activity against methi cillin resistant strains but a lso anti- neoplastic effect on precance rous cell s . Fluorescence in situ hybricli zation in chromosome was not successful due to weak signal. and genornic Southern of hSHP-l showecl a higher weak bancl. which is not clearly definecl as an comrnon genomic locus‘ but could be cons idered its or igin from centromere region which contains less frequent restri ction sites. And more, th e ordinary PCR cloning performed pre vious ly from human genornic DNA produced only repetitive non-specific DNAs which were not matched to hSHP-l cDNA This study demonstrated how we have don e the PCR cl oning usi ng ha irpin primer and cDNA template reve rsely transcribed by gene specific primer.
공간 해상도 1m 이하의 고해상도 원격 탐사 영상의 민간 활용이 활발해 짐에 따라, 이를 위한 전문 분야 별 영상 분석 방법의 개발 요구가 증가하고 있다. 다양한 영상분석 기법 중에, 주변 화소들간의 공간 분포 관계에 의해 특성이 결정되는 텍스처 영상의 분석은 이러한 목적을 위한 유용한 영상 분석 방법 중 하나이다. 이 연구에서는 원시 영상으로부터 GLCM 알고리즘에 의해 생성된 텍스처 영상에 대해서 방향 인자, 마스킹 커널의 크기, 변수의 종류에 따른 결과를 비교, 분석한 뒤 각각의 결과 영상의 지형공간 특성 분석의 적용성에 대하여 알아보았다. 또한 원시 영상과 텍스처 영상에서 특성 정보를 포함하는 템플레이트를 설정하고 이를 기준으로 반복적인 패턴을 자동으로 검색하는 템플레이트 정합 프로그램을 구현하여 이를 원시 영상과 텍스처 영상에 적용하였고, 처리 결과에 기초하여 향후 적용 가능성을 검토하였다. 이 연구의 결과는 일정한 패턴으로 나타나는 지구과학적인 지형 특성이나 고해상도 위성영상 정보를 이용한 인공 지형지물의 파악 및 분석에 효과적으로 적용될 수 있을 것으로 예상된다.
심부 및 천부 지질 환경을 갖는 지하 모암 내의 방사성 폐기물 처분장으로부터 유출된 핵종은 다양한 인공 및 지하 매질을 거쳐 궁극적으로 인간 생태환경으로 도달하게 된다. 그 결과로 인간에게 주는 피폭선량률을 정량적으로 계산하는 것은 처분안전성 평가의 최종 단계가 된다. 방사성폐기물에 포함된 핵종에 대해 붕괴사슬을 고려하고 방사성폐기물처분 시스템의 주요한 부분을 이루는 생태계를 구획으로 모델링 한 후 이들 구획간의 핵종이동에 대한 전이계수를 적용하여 동적 구획모델을 기반으로 하는 AMBER를 이용한 케이스화일로서 ACBIO템플릿을 개발하고 이를 이용하여 각 핵종별 선량환산인자를 평가해 보았다.
Porous graphite was synthesized by removal of template in HF after pyrolysis of pyrolyzed fuel oil (PFO) at using the template of Co or Ni intercalated magadiite. Porous graphite had a plate structure like template, and d-spacing value of about 0.7 nm. The extent of crystallization of porous graphite was dependent on the contents of Co or Ni intercalated in interlayer. It can be explained that the metal such as Co and Ni acts as a promotion catalyst for graphite formation. Porous graphite shows the surface area of .
RAPD-PCR(Random Amplified Polymorphic DNAs-Polymerase Chain Reation) 기법에 누에의 유전적 변이 분석을 위한 첫 단계로 다양한 GC함량을 갖는 random primer에 의해서 증폭되는 DNA 단편의 양상 및 증폭도를 비교하였다. RAPD-PCR을 위한 random primer의 증폭도는 GC함량에 의해서 상당히 영향을 받음이 분석되었다. 특히, 50% GC 함량을 갖는 primer는 그 증폭도에 따라서 4가지의 그룹으로 DNA단편이 증폭되었으며 〔bad amplification (75.5%), poor amplification (11.1%), good and excellent amplification(11.1%)〕, primer의 GC 함량이 증가할수록, 휠씬 더 좋은 증폭도를 보여주었다. 그러나, 40% GC 함량을 갖는 primer에 의해서는 어떤 증폭산물도 관찰되지 않았다. PCR을 수행하기 전에 6가지의 제한효소(BamHI, HindIII, Xbal, HaeIII, MspI, Rsal)를 사용하여 누에 genomic DNA를 처리하여 이를 주형 DNA로 하여 RAPD-PCR을 수행한 결과, 유전적 마커의 생산에 대한 효율이 증가함을 알 수 있었다. 이상의 결과를 종합해 볼 때 60%이상의 GC함량을 갖는 random primer와 전처리한 주형 DNA의 사용은 여러 가지 다른 누에 계통의 동정 및 연관군 지도작성에 따른 경비 및 시간을 줄이는데 효율적이라고 사료된다.