Wolfiporia cocos is an edible fungus commercially cultivated in Asia. To investigate metabolic changes of W. cocos mycelia under both light and dark culture conditions, gas chromatography mass spectrometry (GC-MS) and high-performance liquid chromatography (HPLC) analyses were performed. In terms of the total amount of sugars, alcohols, amino acids, organic acids, fatty acids, and purines, there no significant differences between the W. cocos mycelia cultivated under light (L) or dark (D) conditions (p < 0.05). However, there were some differences with respect to the production of particular sugars and proteins. The levels of trehalose (L: 17.2 ± 0.3% vs. D: 13.9 ± 1.6%), maltose (L: 0.9 ± 0.1% vs. D: 0.3 ± 0.1%), turanose (L: 0.7 ± 0.2% vs. D: 0.1 ± 0.1%), glutamine (L: 1.6 ± 0.3% vs. D: 0.7 ± 0.2%), and proline (L: 0.3 ± 0% vs. D: 0.1 ± 0%) were all significantly higher under light condition (p < 0.05). In contrast, the levels of galactose (L: 13.7 ± 1.2% vs. D: 17.6 ± 2.0%), aspartic acid (L: 0.6 ± 0.1 % vs. D: 0.9 ± 0.1%), cystathionine (L: 0.6 ± 0.1% vs. D: 0.8 ± 0 %), and malic acid (L: 0.7 ± 0.1% vs. D: 1.2 ± 0.1%) were higher under the dark condition. It is worth noting that the amount of pachymic acid, a pharmaceutically active compound of W. cocos, was 1.68 times greater under the light condition (p < 0.05).

There are generally two kinds of spent filter; one is spent filter media for mainly gaseous purification such as HEPA filter, the other is spent filter cartridge for liquid purification such as CVCS BRS cartridge type filter. The spent filter cartridge from liquid purification system has been storing in special shielding space in auxiliary building in NPPs since the beginning of 2006 according to the long term storage strategy for decaying short lived radionuclide and gaining the time for selecting practical treatment technology before final packaging. The spent filter cartridges generated Kori-1 reactor vary in their sizes as in length from 913 mm to 290 mm and range in radiation level from several hundred mSv per hour to below mSv per hour . It is high time that the spent filter cartridge is treated and packaged because LILW repository in Wolsung area is operating and Kori-1 reactor is scheduled to decommission. The spent filter cartridge is one of the wet solid wastes required of solidification. It is difficult for the spent filter cartridge to solidify because of their shape, structure, physical and chemical characteristics in addition to having high radiation level. NSSC notice defines that solidification of wet solid wastes include that solid material such as spent filter is encapsulated with cement, etc. as a form of macro-encapsulation. The radioactive waste acceptance criteria describes that non-homogeneous waste having above 74,000 Bq/g such as spent filter, dry active waste should be encapsulated with qualified material. Homogeneous waste such as spent resin, sludge, concentrated waste (liquid waste evaporator bottoms), etc. should be solidified complied with requirements except that spent filter which is allowed to encapsulate. It is needed to guide to the practice of these two requirements for spent filter. The sampling and test method is different between homogeneous solidification waste form and spent filter cartridge encapsulation waste form. For example, how core sample can be taken and how void space can be measured among spent filter cartridge in encapsulation waste form. The technical evaluation report for spent filter cartridge polymer encapsulation by US NRC has been reviewed and the technical position of US NRC was identified. As a result of review, improvement fields of waste acceptance criteria for spent filters are pointed out, and the technical position of US NRC for spent filter cartridge solidification is summarized. The recommendation on improvement directions for spent filter cartridge encapsulation is suggested.

본 연구는 기존에 재배된 바 없었던 암대극을 새로운 관상식물로 개발하고자, 절화 특성 평가를 실시하였다. 2017년 3월과 4월, 제주도에 자생하고 있는 암대극을 채취한 후, 수분흡수, 절화수명, 노화 과정 등 절화수명 특성을 평가하였다. 또한 sucrose 농도, 절화길이, pH 농도, 저장온도에 따른 절화 특성을 조사하였다. 본 실험은 국립수목원 유용식물증식센터의 Phyto-garden system(12h photoperiod, 25℃, 70% RH)과 실온(23℃, 44% RH)에서 수행하였고 2~3일 간격으로 수분흡수량, 생체중, 절화수명을 측정하였다. 실험 환경에 따른 연구에서 실온(14.4일) 보다 phyto-garden system(42.4일)의 절화 수명이 약 3배 더 길었고, 절화길이에 따른 연구에서는 절화수명이 20cm, 15.2일, 40cm, 17.4일로 나타났다. Sucrose 농도에 따른 연구에서는 처리에 따른 절화수명 증진 효과는 없었고, pH에 따른 연구의 절화수명은 pH 5, 15.6일, pH 6, 13.4일, pH 7, 13.1일, 증류수, 14.8일이었다. 저장온도에 따른 실험에서, 절화수명은 4℃, 83일, 10℃, 41.2일, 15℃, 35.5 일, 20℃, 17.4일, 실온, 14.4일이었는데, 온도가 감소할수록 절화수명이 길어짐을 알 수 있었다. 결론적으로, 암대극은 비교적 광도와 습도가 높은 환경과 절화길이가 길고 저장온도가 낮을수록 수명이 오래 유지되는 것을 알 수 있었다.

암대극(Euphorbia jolkinii Boiss.)은 우리나라 제주도 및 남부 해안가 암석지에서 자생하는 대극과(Euphorbiaceae)의 다년생 초본식물이다. 등잔모양꽃차례가 황록색으로 3월부터 5월까지 긴 기간 동안 개화하기 때문에 새로운 관상식물로 개발할 가치가 높다. 본 연구에서는 암대극을 재배화하고자 우선적으로 제주도의 자생지 환경과 개체군 분포 특성을 조사하였다. 제주도 전역의 해안을 따라서 암대극 개체의 전수조사를 실시한 결과 40여 지점에 걸쳐 약 14,817개체가 자생하는 것으로 확인되었다. 그 중 제주도 본섬의 동쪽에 위치한 우도에 1,075개체(전체의 7.3%), 북서쪽에 위치한 비양도에 952개체(6.4%), 남쪽에 위치한 가파도에 589개체(4.0%)가 조사되었다. 암대극은 주로 제주도 본섬 남동부 해안가 암석지대에 집중적으로 자생하는 것으로 확인되었고 가파도, 우도, 비양도의 경우에도 섬 동쪽지역에만 분포되어 있었다. 암대극의 생육은 자생지에 따라 차이가 있었다. 초장, 줄기 길이, 줄기 직경은 꽃 크기와 정의 상관관계를 보였다. 모든 지역에서 꽃이 피는 시기는 3월 말로 비슷하게 개화가 시작되었고, 6월 초에는 대부분의 꽃에서 종자가 성숙하여 탈리되었다. 암대극의 주변 식생은 갯개미자리, 돌가시나무, 순비기나무, 갯강활 등 30여 종이 분포되어 있었고, 초본이 80%를 차지하는 데에 반해, 목본은 20%로서 초본식물이 주를 이루었다. 토양의 pH는 8.3~9.4의 범위에 있었으며, 염분 농도는 0.003~0.017%로 나타났다. 유기물 함량은 중문에서 1.9%, 가파도에서 1.4%, 표선면에서 1.0%로 나타났고, CEC는 가파도에서 10.7cmol+/kg, 표선면에서 5.6cmol+/kg, 중문 지역에서 1.3cmol+/kg로 나타났다. 전기전도도는 중문, 가파도, 표선면에서 각각 0.47dS/m, 0.19dS/m, 0.16dS/m으로 나타났고, Cl-은 57.45mg/kg, 63.01mg/kg, 8.12mg/kg으로 나타났다. 중문에서 유효인산은 검출되지 않았다.

The antioxidant and antitumor properties of natural products, often recognized in traditional medicine systems, represent therapeutic modalities to reduce or prevent uncontrolled oxidation processes which in turn potentially ameliorate or tumor based symptoms of chronic diseases. We have studied the antioxidant and antitumor effects of Amanita muscaria (A. muscaria) in vitro and examined whether the A. muscaria has synergistic effects on antioxidant and antitumor properties. Although A. muscaria induced a dose-dependent increase in antioxidant activity, the latter has a consistently higher antioxidant effect. In mouse monocytes, the lipopolysaccharide- (LPS-) induced tumor necrosis- (TNF-) synthesis was significantly inhibited by A. muscaria in a dose dependent manner and synergistic effects were clearly demonstrated with the A. muscaria on TNF- inhibition. A. muscaria effect was also evident on inhibition of nuclear factor-kappa B activity, cyclooxygenase-II activity, and lipid peroxidation in mouse monocytes. This presented results may be a starting point for a comprehensive characterization of biological effects of A. muscaria.

Species diversity of ant fauna inhabiting the university campus in the Seoul Metropolitan city, Hanyang University is documented in this investigation. Totally, 14 species of 8 genera belong to 3 subfamilies discovered in study area. Our results are compared with the previous works on ant fauna in the forest and urban habitats based on species number difference. In study area, site 12 and 13 contain wide forest area and diverse environmental elements such as rotten wood, leaf mold and group of living tree. Site 7 has small forest area, but show wide variety of environments like site 12 and 13. Urbanized region like site 8, 10 or area in construction like site 1 show the most lowest diversity. Aside from diversity, Four ant species, Paratrechina flavipes, Lasius spp., Camponotus japonicas, Tetramorium caespitum, appear at almost all habitat, seems to have strong tolerance to environmental change.

Skin is the outermost organ and acts as a barrier between the organism and environment. Skin protects the organism from environmental insults, such as chemicals, pathogens, and UV light. Much of the protective function of skin is dependent on the epidermis, a multi-layered epithelium that is composed of various cell types such as keratinocytes and melanocytes. Keratinocytes produce protective components through a sophisticated differentiation process. Disturbance of keratinocyte differentiation is related to several skin diseases such as psoriasis and atopic dermatitis. In this study, we prepared extract of combined medicinal plants (ECMP) consisting of Taraxacum platycarpum H. Dahlstedt, Heartleaf Houttuynia, Glycyrrhiza uralensis Fischer, and root bark of Ulmus davidiana. We demonstrated that ECMP enhanced keratinocyte differentiation and barrier functionality using an in vitro cell culture system and in vivo animal test. Treatment of cultured keratinocytes with ECMP resulted in induction of keratinocyte differentiation, as evidenced by increased differentiation markers such as involucrin, loricrin, and filaggrin. In line with these results, ECMP decreased proliferation of keratinocytes cultured in vitro. ECMP applied topically to tape-stripped mouse skins accelerated reduction of transepidermal water loss (TEWL), indicating fast recovery of barrier function. Immunohistochemistry showed that ECMP increased the filaggrin level in tape-stripped mouse skins. These results suggest that ECMP may be applicable for keratinocyte differentiation-related skin diseases.

The purpose of this study is to investigate and reveal the effects that the complex exercise training consisting of aerobic exercise and strength training(sit up, push up) that everyone can easily practice regardless of a time and a place in order to manage practically the physical strength of the aged affects the difference on their body composition and the change of physical fitness level. Looking into the change of body composition of an experimental group, the weight of 2.5kg was reduced after applying complex training for 12 weeks and the body fat mass of 2.65kg was reduced. Also, the abdominal fat of 0.13% was decreased and the muscle mass of 1.56kg was increased. For the change factors of physical fitness, cardiovascular endurance, muscular strength, muscular endurance, balance and flexibility excluding agility showed significant improvement after applying complex exercise training. The improvement of health fitness of the aged under this study was significantly effective to improve specified body functions which had been lowered by aging and insufficient physical activities. So, it is regarded that their health fitness is the important factor to improve the activity competence required for daily life and to lead healthy living by the improved activity competence. Henceforth, it needs to study more the complex composition of several sports, exercise intensity and the frequency based on the previous researches and studies. In addition, it needs to develop the complex exercise training in accordance with various characteristics such as a sex of the aged, an age, a physical fitness level, environment, a disease and the program in consideration of the efficacy and safety during training.

에멀션 기반의 계면활성제를 이용한 주형합성법을 이용하여 산촉매로서 염산과 실리카의 전구체인 테 트라에톡시실란을 사용함으로써 메조다공성 실리카 마이크로스피어를 합성하였다. 테트라에톡시실란의 농도 증가에 의해 구형의 입자 형태가 파괴되었고, 기공구조도 크게 변하였다. 산촉매 농도 증가에 의한 구형의 입자형태 파괴 현상은 적었지만 상대적으로 작은 크기의 구형의 마이크로입자가 더 많이 생성되 었다. 하지만, 산성조건에서 입자들 간의 강한 응집현상이 나타남에 따라 낱개의 분리되어 있는 단일입자 를 얻기 위해서는 초음파 등의 후처리 과정이 필요하였다.

Periodontal ligament (PDL) tissue is a connective tissue that is interposed between the roots of the teeth and the inner wall of the alveolar bone socket. PDL is always exposed to physiologic mechanical force such as masticatory force and PDL cells play important roles during orthodontic tooth movement by synthesizing and secreting different mediators involved in bone remodeling. The Wnt/β-catenin signaling pathway was recently shown to play a significant role in the control of bone formation. In the present study, we applied cyclic tensile stress of 20% elongation to cultured human PDL cells and assessed its impact after six days upon components of the Wnt/β-catenin signaling pathway. RTPCR analysis showed that Wnt1a, Wnt3a, Wnt10b and the Wnt receptor LRP5 were down-regulated, whereas the Wnt inhibitor DKK1 was up-regulated in response to these stress conditions. In contrast, little change was detected in the mRNA expression of Wnt5a, Wnt7b, Fz1, and LRP6. By western blotting we found decreased expression of the β-catenin and p-GSK-3β proteins. Our results thus show that mechanical stress suppresses the canonical Wnt/β-catenin signaling pathway in PDL cells.

Al thou gh it was reported that the human genome had been entirely seq uenced. so far there frequently appeared non - redundant cDNAs in gene cloning of cellular mRNAs. Consequently a lot of effort is required to ide ntified the new genes for theil‘ localization in chromosome and their functlons If the new genes had small size sequences 0 1' were expressed in low level , 5' RACE became ha rd unexpectedly. Here. we demonstrated a new method of 5’ RACE by PCR cloning using hair pin prime r and cDNA template produced by gene specific primer. Firstly .. total RNA obtained from tissue 0 1' cells is primed for rever se transcri ption (Superscript lI) by antisense primer (AS-l) specilïc to the objective gen e in order to produce single strand cDNAs The cDNAs usua lly have 3' overhanging of CCC seq uence. SeconcUy, a hail‘ pin primer overhang GGG seq uence in 3' end (i .e ‘ Tn'AGTGAGGGTTA AGAAGGAGAATTAACCCTCACTAAAGGG) is rnixed with the cDNA produced above, and 1'01- lowed by heating at 70'C for 5 min and cooled in room temperature to make hairpin-end template cDNAs Thirdly, For PCR is performed using the ha irpin-end template cDNAs and primer set of inner hairpin sense primer (i . e., TAACCCTCACTA AAGGGG) and AS-1 using pfu polymerase. And next. the PCR product can be directly sequenced 0 1' subcloned into vector to seq uence the purified plasrnid DNA. In our laboratory several unidentified new genes have been under investigation for theil‘ genomic l oci and functions. However. one of them. a human short helical protein 1 (hSHP-1) was a short gene less than 600 bp in s ize. encoding 45 amino acids . hSHP-1 is able to produce a potent antimicrobial peptide which has similar strength to magainin from frogs. The hSHP-1 also showed multifunctional roles of innate imrnunity including not only the ant imicrobial activity against methi cillin resistant strains but a lso anti- neoplastic effect on precance rous cell s . Fluorescence in situ hybricli zation in chromosome was not successful due to weak signal. and genornic Southern of hSHP-l showecl a higher weak bancl. which is not clearly definecl as an comrnon genomic locus‘ but could be cons idered its or igin from centromere region which contains less frequent restri ction sites. And more, th e ordinary PCR cloning performed pre vious ly from human genornic DNA produced only repetitive non-specific DNAs which were not matched to hSHP-l cDNA This study demonstrated how we have don e the PCR cl oning usi ng ha irpin primer and cDNA template reve rsely transcribed by gene specific primer.

om llnique miRNA encoding genes and also from intergene seqllences. 80 far it is generally suggestecl that one miRNA could target multiple genes. and also several miRNAs could be orchestrated to downregulate a s pecific gene. However. there would be many possibilities to procluce more miRNAs and to target gene in more compli catecl manners tha n we expected Here‘ we developed a detection program of miRNA consensus sequences from non- cocling region of genetic corcls As the ha irpin structure 01' tRNA has step-loop like hybridi zation by a single strand RNA. the repeated 3-5 nt symmetric arrangement with 6- 12 nt spanning sequences for hail‘pin head is necessary to form a preCllrsor rruRNA The DNA base pair‘ polarity program symbolizecl by the electrostatic polarities of pyrimidine and purine is now reinforcecl by the cletection program fOI symmetric DNA strand from non-coding regions. For example, we iclentifi ecl candidate miRNAs targeting eIF5A mRNA (miR-eIF5A-l)‘ 288 ribosomal RNA (miR- 28S-1). and dentin sialophosphate protein mRNA (miR- D8PP-1). 1n t his study the detection methocl of 288 ribosomal RNA was demonstrated ancl the molecular biological effects 01' miRNA targeting in vitro culture system were evaluatecl by miRNA RT• PCR, Northen blot, siRNA interference, and in situ hybridization. We firstly sea rched the candidate miRNA from the intron sequences of each objectiγe gene using the programs of syrrunetric sequence cletection a ncl DNA base pair polarity, ancl secondarily siRNA procluced by in vitro transcription and inclucible lenti virus vector cons tru ction was transfectecl into HEK293 cells. The transfectecl siRNA of miR-28S-1 was accumulated in the nucleoli ancl inclllced apoptosis extens ively in 2 days cultur8. Northern blot using miR-288-1 probe showed strong reaction in t he 288 bancJ of total RNA and also showed a smeared band in small size representing the presence of t he precursor and mature miRNAs 이 miR-288-1. In in situ hyridi zation most of cells revealed intensive miR-288-1 positive reaction in their cytopl asms. mirni cking t he abllndant localization of 288 RNA From the above study. we presume that rniRNAs targeting s pecific genes are possibly derivecl from the in tron seq uences of the objective gene, and suggest that the symmetirc sequence detect ion ancl DNA base pair polarity program is useflll to define the candiclate miRNA

The present study investigated the effects of follicle stimulating hormone (FSH) and human chorionic gonadotrophin (hCG) on the nuclear maturation of canine oocytes. Oocytes were recovered from mongrel female ovaries in various reproductive states; follicular, luteal or anestrous stage. Oocytes were cultured in serum-free tissue culture medium (TCM)-199 supplemented with various concentrations of FSH (Exp. 1: 0, 0.5, 1.0 or 10 IU) or hCG (Exp. 2: 0, 0.5, 1.0 or 10 IU) or both (Exp. 3: 1 IU FSH + 1 IU hCG) for 72 hr to determine the effective concentration of these hormones, and to examine their combined effect. After maturation culture, oocytes were denuded in PBS containing 0.1% (w/v) hyaluronidase by gentle pipetting. The denuded oocytes were stained with 1.9 μM. Hoechst 33342 in glycerol and the nuclear state of oocytes was evaluated under UV light. More (p<0.05) oocytes matured to MII stage when follicular stage oocytes were supplemented with 1 IU FSH (6.2%) compared with the control, 0.1 or 10.0 IU FSH (0 to 1.2%). Significantly higher (p<0.05) maturation rate to MII stage was observed in follicular stage oocytes supplemented with 1.0 IU hCG (7.2%) compared with the control or other hCG supplemented groups (0 to 1.5%). However, the combination of FSH and hCG did not improve the nuclear maturation rate of canine oocyte (2.4 %) compared with FSH (6.2%) and hCG alone (7.2%). In conclusion, FSH or hCG alone significantly increased the maturation of canine oocytes to MII stage.

Background : Acanthopanax sessiliflorus (Rupr. et Maxim) Seem, belonging to the Araliaceae family, is widely distributed in Korea, China, and Japan. The plants belonging to Acanthopanax species are traditionally used in Korea as anti-rheumatoid arthritis, anti-inflammatory and anti-diabetic drugs and are recognized to have ginseng-like activities. A simple and sensitive high-performance liquid chromatographic (HPLC) method was developed and validated for independent analysis of major compounds and chlorogenic acid in A. sessiliflorus fruits. Chlorogenic acid was reported that prevent cancer and cardiovascular disease in vivo. Also, it has antioxidant effect in vitro test. In the previous experiment, chlorogenic acid were found in A. sessiliflorus fruits. This study was performed to identification of the major compounds and investigate the method validation for the determination of chlorogenic acid in A. sessiliflorus fruits. Methods and Results : Three major compounds were recorded on a Varian Unity Inova AS-400 FT-NMR spectrometer and analyzed by the new HPLC analysis method. HPLC analysis was carried out using an Waters e2695 and PDA detector. The new analyasis method was validated by the measurement of intra-day, inter-day precision, accuracy, limit of detection (LOD, S/N=3), and limit of quantification (LOQ, S/N=10) of chlorogenic acid. The results showed that the correlation coefficient (R2) for the calibration curves of chlorogenic acid was 0.997 in terms of linearity. The limit of detection (LOD) and limit of quantification (LOQ) were 0.565 ㎍/ml and 2.88 ㎍/ml, respectively. There was no interfering peak observed each other and HPLC system was suitable for analysis showing goodness of peak and high precision. Conclusion : This method is suitable to detect and quantify major compounds in A. sessiliflorus fruits. Furthermore, the result will be applied to establish chlorogenic acid as an standard compound for A. sessiliflorus fruits.

Background : This study was development of moisture tolerance and high-yielding Rehmannia glutinosa cultivar. Methods and Results : Segang is developed by the medicinal crop breeding team of National Institute of Horticulture and Herbal Science(NIHHS), Rural Development Administration(RDA), during the period from 2005 to 2015. The reproduction of Rehmannia glutinosa has been accomplished mainly by vegetative propagation with its seedlings have many variants. The cultivar was selected from seedling of Jihwang 1(check variety). The plant type of Segang is some rising from ground. Regional yield trials conducted at three site from 2014 to 2015. The root yield of Segang was 21.1ton per hectare, which was increased 12% compared with Jihwang 1. Also, Segang has higher catalpol content and dried root ratio compared with Jihwang 1. Conclusion : Segang is a moisture tolerance and high-yielding Rehmannia glutinosa cultivar.

Mannitol is commonly used to reduce intracranial and intraocular pressures and to prevent dialysis-disequilibrium syndrome. However, intravenous mannitol infusion in various cases has the potential to result in acute kidney injury (AKI). We present a case of mannitol-induced AKI that developed after low dose mannitol infusion and resulted in recovery after hemodialysis. A 66-year-old woman was admitted to the hospital with a diagnosis of left middle cerebral artery infarction. On hospital day 5, cerebral edema was observed on a follow-up MRI. D-mannitol 35 g was given intravenously every 8 hours. Four days later, serum creatinine levels were elevated from 1.2 mg/dL to 3.5 mg/dL. The serum osmolal gap was found to be 52.4 mosm/kg H2O and urine output was reduced from 2.78 mL/kg/h to 0.69 mL/kg/h over three days. Hemodialysis over 2 hours was performed and renal function subsequently improved to baseline function. A potential risk of AKI exists even with low dose mannitol infusion in patients with advanced age, underlying renal impairment, and concomitant use of nephrotoxic agents. Mannitol-induced AKI may be rapidly reversed by short-term hemodialysis.