In order to know the degenerating state of postnatal cleft lip tissue, total 23 cases of lip biopsy obtained from cleft lip surgery were collected and examined pathologically. The cleft lip tissues characteristically disclosed epithelial hyperplasia (13/23), stromal myxoid degeneration (20/23), salivary gland degeneration (1/23), muscular degeneration (11/23), and sebaceous gland hyperplasia (15/23), melanocytic infiltration (5/23). The epithelial hyperplasia was marked with hyperkeratosis and basal hyperplasia, which was usually coincident with the myxoid degeneration of underlying connective tissue. The myxoid degeneration was diffuse in the deep connective tissue with chronic inflammatoryreaction, and followed by extensive muscular degeneration. The sebaceous gland hyperplasia was usually predominant in the skin area of the cleft lip. In this study the lip biopsy from 30years old patient still showed remarkable retrogressive degeneration of lip tissue. Therefore, it is considered that the postnatal cleft lip tissue is continuously degenerative, and its retrogressive change gradually affects the deterioration of perioral muscular structures, consequently resulted in the failure of lip functions as well as further bizarre malformation of oro-facial shape during the postnatal period. These data also indicate that the biopsy of postnatal cleft lip should be recommended to know its variable degenerating status and to perform the proper rehabilitation surgery of cleft lip.
A case of chronic osteomyelitis caused by prolonged intake of bisphosphonate showed multiple recurrences involving extensive area of mandibular body. After saucerization the removed bony fragments were decalcified, microsected in 4 ㎛ thickness, and stained with hematoxylin and eosin, Masson trichrome, von Gieson, and periodic acid Schiff reaction. The inflammatory lesion contained fragile osteophytes easily propagated into sequestra. Histologically, this osteomyelitis was relatively less suppurative but almost granulomatous, highly infiltrated with small round cells and macrophages. The osteophytes were frequently deposited on the old lamellate bone, but their ossification was extremely immature and frequently filled with sclerosed collagen bundles positive for von Gieson stain. In the polarizing microscope observation under Masson trichrome stain the newly deposited osteophytes were lack of birefringence image of Haversian system contrast to the old bone nearby. Therefore, we presume that the prolonged intake of bisphosphonate may induce the immature osteophytes lack of Harversian system, which are partly filled with sclerotic collagen bundles, and the immature bone is easily undergone extensive degeneration and necrosis, resulted in the inflammatory foci for multiple recurrent osteomyelitis.
Although the sparganosis involving soft tissues, i.e, tongue, cheek, etc., has been frequently reported, the mandibular involvement of sparganosis is not reported up to date. We present a case of intraosseous sparganosis involving whole mandible, which was clinically diagnosed as chronic osteomyelitis. After surgical operation of saucerization for the treatment of chronic osteomyelitis the removed specimens were pathologically examined and finally turned out intraosseous sparganosis. Radiological findings showed irregular multiple radiolucencies in round to ovoid shape throughout both mandibular body areas, of which peripheral rarefying radiopacity was less remarkable compared to the ordinary osteomyelitis. However, the radiolucencies of periapical granuloma, #34-36, were closely associated with the osteolytic lesions of mandibular body. Pathological examination showed a tunnel like space for the passage of sparganum larva, and heavy infiltration of eosinophilicleukocytes. And more, the parasitic tegument materials were found admixed with eggs in the granulomatous lesion, which were gradually degraded and resolved. Taken together, we presumed that the mandibular inflammatory lesion was primarily involved with sparganosis and secondarily aggravated by the periapical infection of #34-36.
The polarizing images of hard tissues including bone and cementum show characteristic features of different birefringence fortheir microstructures. Nevertheless, the clear mechanism of the amplified birefringence under polarizing microscope has not been well understood. We hypothesized that the unique polarized light could be accumulated in the microtubules due to the decreased refractory angle by the inside lower-density matrix, and then the accumulated light in the microtubules could be dispersed brightly. In order to elucidate the polarizing effect on the microtubules, the dentinal tubules in different conditions were observed, and compared with each other to explain their birefringence phenomena. In the decalcified sections of normal tooth, the dentinal tubules located near the pulp chamber showed strong birefringence, while the sclerosed dentinal tubules near the dentino-enamel junction did not show the birefringence. The birefringence was more conspicuous in the longitudinal sectionsof dentinal tubules than in the cross sections. In the decalcified sections of complex odontoma, which produced abnormal and immature dentinal tubules, the birefringence was not observed in the shrunken dentinal tubules filled with dense materials, while the peritubular matrix showed clear birefringence. The birefringence was also observed in the collagen fibers in the connective tissue, and continuously strong in the immature cemental materials containing precollagen fibers. However, the highly mineralized osteodentine did not show the birefringence. Taken together, these data suggest that the microtubules composed ofless-dense matrix than the background tissue, i.e., dentinal tubules, Haversian canals, etc., produce the amplified birefringence by the polarizing light according to the hypothesis of microtubule refraction.
53 years old female showed repeated ulceration of labial gingival mucosa at upper and lower anterior teeth, which was a partly desquamated and erythematous lesion. The lesion was slightly extended into vestibule and buccal mucosa in oral cavity, but the similar lesion was not found in other organs by medical inspection. The incisional biopsy including the border of the ulcerated mucosa and normal mucosa showed a severely inflamed mucosa, of which epithelium was gradually detached from the underlying conective tissue, so that it was diagnosed as a mucous membrane pemphigoid (MMP) pathologically. The epithelium was thinned, almost lost its rete pegs, and the basement membrane was completely distorted by the epithelial detachement. The inflammatory cell infiltration was mainly composed of small round cells and plasma cells. Immunohistochemistry was performed to know the expression of pathogenetic proteins using antisera of Igk, E-cadherin, laminin a5, elafin, and eIF5A. The basement membrane at the epithelial detachment was condensely positive for Igk, and the involved epithelium became atrophic but showed consistently positive reaction of matrix proteins and protein translation factor, i.e., E-cadherin, laminin a5, elafin, and eIF5A similar to the adjacent normal mucosa continuous to the MMP lesion. The Igk was also diffusely deposited on the basement membrane of nearby normal mucosa. Many plasma cells infiltrated around the lesion were strongly positive for Igk in their cytoplasms. Therefore, we suggest that the MMP be characterized by the deposition of Igk on the basement membrane of the detached epithelium in the absence of no other pathognomic changes of molecular events.
Most of mucous retention phenomena occurred in the mucous secretory glands, 1 e ‘ minor salivary gland, sublingual gland and submandibular gland. The mucous retention cyst from parotid gland has been very rarely reported in the literature As the parotid gland is composed of serous acini, the serous saliva is less likely to produce the retention phenomenon in the ducts or extraductal tissue. Here, a case of mucous retention cyst in parotid gland was demonstrated The patient of this case has been complaining of recurrent swelling of right cheek in parotid gland a'rea, and showed a feature of chronic sialadenitis or benign salivary gland tumor. The extravasated serous saliva was diffusely dispersed into the adjacent connective tissue, forming an ill-defined cyst cavity with hyalinized sclerotic luminal surface The inflammatory reaction was relatively mild compared to the extensive destruction of periglandular connective tissue However, the typical foamy macrophage was not seen but the infiltrated macrophages containing abundant eosi nophilic cytoplasm. The mucous retention phenomenon could be very rare in parotid gland, which is also easily distinguishable from chronic sialadenitis or benign tumor through path이ogical examination.
In order to develop a protective carrier scaffolder for the external usage of medical and hygienic materials, three essential protective elements existing in nature, i.e., algin, cellulose, and calcium phosphate apatite, were investigated. The algin is a main skeletal component of sea weeds, the cellulose is of vegetables, and the calcium phosphate apatite is of vertebral animals. In the present study we select the agarose which is a derivative from algin, the cellulose fiber obtained from skin of sea squirt, calcium oxide purified from shell powder, and tricalcium phosphate apatite purchased commercially. Consequently, the agarose-cellulose hybrid was made by the hydrogen bonds intermediating the calcium phosphate apatite between agarose and cellulose molecules. As the calcium phosphate apatite is formed by the addition of calcium hydroxide into tricalcium phosphate solution, we used calcium oxide to accelerate the hybridization between the agarose and calcium phosphate apatite and also between the cellulose and calcium phosphate apatite. In the phase contrast microscopic observation the agarose-cellulose hybrid showed more compact matrix structure than the mixture of agarose and cellulose. The agarose-cellulose hybrid showed increased storage modulus but decreased loss modulus in Rheometer test compared to those of the other materials tested in this study, representing that the agarose-cellulose hybrid has the highest elasticity among them and similar water capacity to agarose. The agarose-cellulose hybrid showed the strongest antimicrobial effect in bacteria killing assay than the other materials, and also it showed a potent blood clotting effect but no immunological hypersensitivity on the human skin. From the above results we presumed that the nobel material, agarose-cellulose hybrid, is a compact scaffolding matrix which has proper elasticity, high capacity to hold substrates, and antimicrobial and blood clotting property potent enough to carry the bio-medical and hygienic materials for external treatment safely.
35 peri-implantitis recently referred for 10 years showed four types of inflammatory lesions, such as mild granulomatous lesion(n=5), severe granulomatous lesion(n=4), severe inflammatory fibrous scar tissue(n=15), severe abscess formation(n=11). However, the inflammatory lesions were usually localized at the peri-implant area accompanying compensatory hyperplasia of fibrous connective tissue. The fibrous scar and the necrotic abscess frequently occurred depend on the severity of inflammatory reaction. Among 30 cases of severe inflammatory lesions, only 2 cases involved condensing osteitis in adjacent alveolar bone. Thus, we suppose that the inflammatory progression of peri-implantitis could be partly inhibited by the hyperplastic fibrous stromal tissue stimulated by implant material. And more, the focal abscess formed around the implant can be easily drainaged through the fibrous tract of implant pathway, resulted in the chronic persistent inflammatory granulomatous lesion, that is contrast to the common socket granuloma after tooth extraction. However, depend on the degree of inflammatory reaction in the peri-implantitis the inflamed fibrous collagenous tissues, unregenerated graft materials, necrotic abscess and sequestra should be removed by surgical intervention and followed by antibiotic therapy, because the peri-implant tissue is as vivid as the normal periodontium for the inflammatory defense system. Therefore, we suggest that the inflammatory lesions of peri-implantitis be carefully treated to improve the prognosis for the following dental treatments
Al thou gh it was reported that the human genome had been entirely seq uenced. so far there frequently appeared non - redundant cDNAs in gene cloning of cellular mRNAs. Consequently a lot of effort is required to ide ntified the new genes for theil‘ localization in chromosome and their functlons If the new genes had small size sequences 0 1' were expressed in low level , 5' RACE became ha rd unexpectedly. Here. we demonstrated a new method of 5’ RACE by PCR cloning using hair pin prime r and cDNA template produced by gene specific primer. Firstly .. total RNA obtained from tissue 0 1' cells is primed for rever se transcri ption (Superscript lI) by antisense primer (AS-l) specilïc to the objective gen e in order to produce single strand cDNAs The cDNAs usua lly have 3' overhanging of CCC seq uence. SeconcUy, a hail‘ pin primer overhang GGG seq uence in 3' end (i .e ‘ Tn'AGTGAGGGTTA AGAAGGAGAATTAACCCTCACTAAAGGG) is rnixed with the cDNA produced above, and 1'01- lowed by heating at 70'C for 5 min and cooled in room temperature to make hairpin-end template cDNAs Thirdly, For PCR is performed using the ha irpin-end template cDNAs and primer set of inner hairpin sense primer (i . e., TAACCCTCACTA AAGGGG) and AS-1 using pfu polymerase. And next. the PCR product can be directly sequenced 0 1' subcloned into vector to seq uence the purified plasrnid DNA. In our laboratory several unidentified new genes have been under investigation for theil‘ genomic l oci and functions. However. one of them. a human short helical protein 1 (hSHP-1) was a short gene less than 600 bp in s ize. encoding 45 amino acids . hSHP-1 is able to produce a potent antimicrobial peptide which has similar strength to magainin from frogs. The hSHP-1 also showed multifunctional roles of innate imrnunity including not only the ant imicrobial activity against methi cillin resistant strains but a lso anti- neoplastic effect on precance rous cell s . Fluorescence in situ hybricli zation in chromosome was not successful due to weak signal. and genornic Southern of hSHP-l showecl a higher weak bancl. which is not clearly definecl as an comrnon genomic locus‘ but could be cons idered its or igin from centromere region which contains less frequent restri ction sites. And more, th e ordinary PCR cloning performed pre vious ly from human genornic DNA produced only repetitive non-specific DNAs which were not matched to hSHP-l cDNA This study demonstrated how we have don e the PCR cl oning usi ng ha irpin primer and cDNA template reve rsely transcribed by gene specific primer.
om llnique miRNA encoding genes and also from intergene seqllences. 80 far it is generally suggestecl that one miRNA could target multiple genes. and also several miRNAs could be orchestrated to downregulate a s pecific gene. However. there would be many possibilities to procluce more miRNAs and to target gene in more compli catecl manners tha n we expected Here‘ we developed a detection program of miRNA consensus sequences from non- cocling region of genetic corcls As the ha irpin structure 01' tRNA has step-loop like hybridi zation by a single strand RNA. the repeated 3-5 nt symmetric arrangement with 6- 12 nt spanning sequences for hail‘pin head is necessary to form a preCllrsor rruRNA The DNA base pair‘ polarity program symbolizecl by the electrostatic polarities of pyrimidine and purine is now reinforcecl by the cletection program fOI symmetric DNA strand from non-coding regions. For example, we iclentifi ecl candidate miRNAs targeting eIF5A mRNA (miR-eIF5A-l)‘ 288 ribosomal RNA (miR- 28S-1). and dentin sialophosphate protein mRNA (miR- D8PP-1). 1n t his study the detection methocl of 288 ribosomal RNA was demonstrated ancl the molecular biological effects 01' miRNA targeting in vitro culture system were evaluatecl by miRNA RT• PCR, Northen blot, siRNA interference, and in situ hybridization. We firstly sea rched the candidate miRNA from the intron sequences of each objectiγe gene using the programs of syrrunetric sequence cletection a ncl DNA base pair polarity, ancl secondarily siRNA procluced by in vitro transcription and inclucible lenti virus vector cons tru ction was transfectecl into HEK293 cells. The transfectecl siRNA of miR-28S-1 was accumulated in the nucleoli ancl inclllced apoptosis extens ively in 2 days cultur8. Northern blot using miR-288-1 probe showed strong reaction in t he 288 bancJ of total RNA and also showed a smeared band in small size representing the presence of t he precursor and mature miRNAs 이 miR-288-1. In in situ hyridi zation most of cells revealed intensive miR-288-1 positive reaction in their cytopl asms. mirni cking t he abllndant localization of 288 RNA From the above study. we presume that rniRNAs targeting s pecific genes are possibly derivecl from the in tron seq uences of the objective gene, and suggest that the symmetirc sequence detect ion ancl DNA base pair polarity program is useflll to define the candiclate miRNA
[n order to obtain the trlle expected DNA prod uct from PCR and RT-PCR using genornic DNA or cDNA reversely transcribed from mRNA. the PCR should be done in an appropriated condition. Sometimes the PCR was repeatedly fail ed. and cventllally the PCR product was turned out to be nonspecific and rudimentary . And more‘ t he PCR prodllctwas not reproducible even though careflll repeat of experiments. As the PCR was based on the exact primel hybridization. the condition of primer hybridization should be properly controlled by a nnealing temperatllre. But the selection of primer seqllences for targeting a specific gene is mostly important. A new method of primer eval uation is now available llsing DNA base pair polarity program. This study presents an example of PCR targeting to human Bax gene using genomic DNA. The DNA base pair polarity theory can di vide the genetic cord into propel DNA segments and calclllaLe their DNA base pair hybridization energy. Thus. mathematically the degree 0(' exact primer hybridization can be expected for the t r1l8 targeting of PCR. However, the DNA base pair polal'ityanalysis demonstrates that the more frequent number of DNA segment incl'eased the specificity of PCR. but decreased its sensitivity . While the greater polarity of DNA segment composed of increased nllmber of polarized DNA base pairs showed increased sensitivi ty 0 1' PCR. bllt relati vely decreased specificity of PCR. With the mllltiple analysis of PCR. especially for PCR cloning from the gDNA and cDNA, we found that the primers themselves showed secondary strllcture of partial hybridization between sameprimers or each pair primers. The DNA base pail‘ polarity signal can directly demonstrated symmetric sequences 0 1' each primer. and also can distinguish the dimmer formation from each pair primers. At least the symmetric seqllence of fOlll‘ base pairs dramatically showed the dimrner formation. On the other hand. in addi tion Lo the statlls of DNA base pair polarity the three-dimensional strllctllre of DNA dOllble helix targeted by the primer seqllences may affect the sensitivity and specificity of PCR detection. The present study introduced a new method of primer evalllation and selection in order to obtain abundant and exacL! y-trlle DNA product for genomic ffilltation analysis and gene expression profï le
In order to perform the protein analysis using the paraffin sections previous fixed with formalin, we applied the ImmunoMemBlot (IMB) method1) to detect the epitopes of target proteins with specific antibodies. In this study the protein extracts were obtained from the paraffin sections of each representative case of ameloblastoma, adenomatoid odontogenic tumor (AOT), and normal gingiva, and more a protein extract from fresh tissue of ameloblastoma was also compared to evaluate the IMB results used with 24 different antibodies. First of all, in the comparison between the paraffin section extract and fresh tissue extract of ameloblastoma, the latter consistently showed more positive IMB reaction than the former. Meanwhile, the paraffin section extract of ameloblastoma was more comparable with that of normal gingival, disclosing that most of proliferating genes, oncogenes, and apoptosis related genes, i.e., PCNA, CDK4, c-erbB2, CEA, p53, Bax, Bad, FLIP, FAS, Bcl-2, p21, N-ras, MMP-2, MMP-9, caspase-3, -8, -9, were highly expressed in ameloblastoma, but EGFR, HGF, and VEGF were similarly expressed both in the ameloblastoma and in normal human gingiva. On the other hand, the comparison between ameloblastoma and AOT both in the immunohistochemistry and IMB using their paraffin section extracts clearly demonstrated that the ameloblastoma showed more expression of proliferating genes and oncogenes while the AOT showed more expression of apoptosis related genes, i.e., Bax, Bad, FLIP, and caspase-9. Taken together, these data suggest that the IMB can be used for the primary screening of quantitative protein analysis using the paraffin section extract, and that the IMB results could be evaluated in conjunction with the immunohistochemical observation.
Immuno-MemBlot is a technique for detecting, analyzing, and identifying proteins, similar to the Western blot technique but differing in that protein samples are not separated electrophoretically but are spotted through circular or slot templates directly onto the membrane. Recently we developed a new Immuno-MemBlot (IMB) method applying immunoreactions and coloring procedures directly in the wells of MemBlot apparatus, which were connected by canals to perform drainage for reagent application and buffer irrigation. This IMB method was designed to get theimmunoblot results more rapidly and clearly than the previous immunoblot ones. This study is aimed to evaluate the analytical accuracy of IMB using different biological assay. In the sensitivity test of IMB the monoclonal antibody can clearly detect the 30 ng (about 12 pM) of Mucocidin peptide (35 mer), and is also available to detect at least 10 ng (about 4 pM) of Mucocidin peptide (35 mer). The IMB was effective in the quantitative analysis of methothrexate (MTX) assay for cellular apoptosis. And more, this IMB is useful to screen large number of specific samples with ease and accuracy in a short time. In the screenings for the presence of Mucocidin in saliva the quantitative comparison is conspicuous among 48 persons depend on the different conditions ofgender, drinking and smoking habits, and oral diseases. Therefore, it is presumed that, even though the target proteins were partly degraded, a specific epitope can be detected if a monoclonal antibody was still reactive. Conclusively, these data suggest that the IMB can be useful in the primary qualitativeand quantitative analysis of proteins in various fluids, i.e., blood, saliva, tear, urine, etc.
As pulp calcification occurs at least fifty percent of total teeth, the focal calcification in pulp chamber usually appears in all age groups. However, the pulp calcification is one of the important pathologic changes affecting the pulp vitality. In order to elucidate the mechanism of pulp calcification during the retrogressive degeneration of pulp tissue we performed an immunohistochemical study for proteases (MMP-3, MMP-10, and cathepsin-G), antiproteases (TIMP-1, α1- AT) and proteins involving tissue protection (TGase-2 and HSP-70). In the normal pulp tissue MMP-3 and MMP-10 were weakly expressed, but cathepsin-G and TIMP-1 were rarely expressed. Around the calcifying tissue of MMP-3, MMP- 10, and α1-AT were predominant, but TIMP-1 and cathepsin-G were sparsely expressed. On the other hands, TGase-2 and HSP-70 were condensed in the proximal fibrous tissue. These data suggest that the pulp calcification is related to retrogressive pulp degeneration, which could be resulted in the incomplete digestion of the degenerated stromal tissue by different proteases. We presume that the aberrant protease digestion of chronic pulpal pathosis, i.e., sclerotic fibrosis, chronic pulp degeneration, etc., may enhance the dystrophic calcification in dental pulp.
The primary growth center (MdPGC) of human fetal mandible was conspicuously distinguished in the soft X-ray view of fetal mandibles.1) As the peripheral adaptive growth of mandible advanced during the postnatal period, the MdPGC became overshadowed by condensed cortical bone. However, in the well-processed radiograms of adult mandible a condensed radiopaque image, measuring 0.5-1.0 cm in diameter, can be observed below the apex of first premolar. In this study we aimed to trace a sclerotic sequela of mandibular primary growth center during postnatal period. Panoramic radiograms of two hundreds adults and soft X-ray views of thirty dry mandible were analyzed by statistical methods. The adult MdPGC was clearly distinguishable from the mental foramen. The area of MdPGC was seldom changed in the older persons, even in the edentulous mandibles. Additionally, the benign lesions of odontogenic cysts and tumors hardly destroyed the original structure of MdPGC, while the malignant tumors of squamous cell carcinoma and metastatic cancer rapidly destroyed and resolved the radiopaque area of the MdPGC.